\
| Variant ID: vg1021148698 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 21148698 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCAAAATTGGTAAGTTGTGAACTAGGTTCGGCATAGGGATCGAGGCAGATTCAACAAGGAGATGGATTCGAAGAACAGAGTATGCATCGGCTACGAAGG[C/T]
ATCGGCTGAAGTATGCATCGGCTGAGATGGATCGGACAGAGGACAGCCAATACAGCCGATAGAGGTGATGCAGCCGATTCCGATGACAATGGTTTCAGAG
CTCTGAAACCATTGTCATCGGAATCGGCTGCATCACCTCTATCGGCTGTATTGGCTGTCCTCTGTCCGATCCATCTCAGCCGATGCATACTTCAGCCGAT[G/A]
CCTTCGTAGCCGATGCATACTCTGTTCTTCGAATCCATCTCCTTGTTGAATCTGCCTCGATCCCTATGCCGAACCTAGTTCACAACTTACCAATTTTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 0.90% | 3.47% | 2.98% | NA |
| All Indica | 2759 | 98.20% | 1.50% | 0.22% | 0.04% | NA |
| All Japonica | 1512 | 81.20% | 0.00% | 9.99% | 8.80% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.70% | 2.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.00% | 0.00% | 10.69% | 5.35% | NA |
| Tropical Japonica | 504 | 77.40% | 0.00% | 8.73% | 13.89% | NA |
| Japonica Intermediate | 241 | 80.50% | 0.00% | 10.37% | 9.13% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1021148698 | C -> T | LOC_Os10g39560.1 | upstream_gene_variant ; 1796.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021148698 | C -> T | LOC_Os10g39560-LOC_Os10g39570 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1021148698 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1021148698 | NA | 6.68E-41 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | NA | 1.26E-50 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | NA | 2.12E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | NA | 5.48E-45 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | NA | 7.64E-14 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | 3.32E-08 | 4.16E-69 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1021148698 | 1.64E-07 | 9.70E-07 | mr1558_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |