\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1021148698:

Variant ID: vg1021148698 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 21148698
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAAAATTGGTAAGTTGTGAACTAGGTTCGGCATAGGGATCGAGGCAGATTCAACAAGGAGATGGATTCGAAGAACAGAGTATGCATCGGCTACGAAGG[C/T]
ATCGGCTGAAGTATGCATCGGCTGAGATGGATCGGACAGAGGACAGCCAATACAGCCGATAGAGGTGATGCAGCCGATTCCGATGACAATGGTTTCAGAG

Reverse complement sequence

CTCTGAAACCATTGTCATCGGAATCGGCTGCATCACCTCTATCGGCTGTATTGGCTGTCCTCTGTCCGATCCATCTCAGCCGATGCATACTTCAGCCGAT[G/A]
CCTTCGTAGCCGATGCATACTCTGTTCTTCGAATCCATCTCCTTGTTGAATCTGCCTCGATCCCTATGCCGAACCTAGTTCACAACTTACCAATTTTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 0.90% 3.47% 2.98% NA
All Indica  2759 98.20% 1.50% 0.22% 0.04% NA
All Japonica  1512 81.20% 0.00% 9.99% 8.80% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.00% 0.67% 0.00% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 84.00% 0.00% 10.69% 5.35% NA
Tropical Japonica  504 77.40% 0.00% 8.73% 13.89% NA
Japonica Intermediate  241 80.50% 0.00% 10.37% 9.13% NA
VI/Aromatic  96 92.70% 1.00% 4.17% 2.08% NA
Intermediate  90 91.10% 0.00% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1021148698 C -> T LOC_Os10g39560.1 upstream_gene_variant ; 1796.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021148698 C -> T LOC_Os10g39560-LOC_Os10g39570 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021148698 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1021148698 NA 6.68E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 NA 1.26E-50 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 NA 2.12E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 NA 5.48E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 NA 7.64E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 3.32E-08 4.16E-69 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021148698 1.64E-07 9.70E-07 mr1558_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251