\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020835773:

Variant ID: vg1020835773 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20835773
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGTGGTCTTTAGCTGGGGTTGCCGCTTTTGGGGATTTCTAGAGAGTGTAACGTGGCTCTGTCCCTTCTCACTTCCCACTGTTAGAAGTTGCGTTTAGC[C/T]
GCCGTAGTAGTTTTTTTCCCTAAGCTTCAGTTTCTGTTTTGCTTTTTCTCTATTCCCTTGGAATAAGCCGGTCTGGAGGATTGTATTGTGTAACAAAAAC

Reverse complement sequence

GTTTTTGTTACACAATACAATCCTCCAGACCGGCTTATTCCAAGGGAATAGAGAAAAAGCAAAACAGAAACTGAAGCTTAGGGAAAAAAACTACTACGGC[G/A]
GCTAAACGCAACTTCTAACAGTGGGAAGTGAGAAGGGACAGAGCCACGTTACACTCTCTAGAAATCCCCAAAAGCGGCAACCCCAGCTAAAGACCACATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.50% 0.32% 0.00% NA
All Indica  2759 95.10% 4.60% 0.29% 0.00% NA
All Japonica  1512 3.60% 95.90% 0.46% 0.00% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.50% 0.51% 0.00% NA
Temperate Japonica  767 2.20% 97.00% 0.78% 0.00% NA
Tropical Japonica  504 4.80% 95.00% 0.20% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020835773 C -> T LOC_Os10g39080.1 upstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg1020835773 C -> T LOC_Os10g39084.1 downstream_gene_variant ; 1913.0bp to feature; MODIFIER silent_mutation Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg1020835773 C -> T LOC_Os10g39090.1 downstream_gene_variant ; 1661.0bp to feature; MODIFIER silent_mutation Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg1020835773 C -> T LOC_Os10g39090.2 downstream_gene_variant ; 1662.0bp to feature; MODIFIER silent_mutation Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg1020835773 C -> T LOC_Os10g39084-LOC_Os10g39090 intergenic_region ; MODIFIER silent_mutation Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020835773 NA 4.90E-21 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 2.65E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 2.77E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 2.35E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 4.52E-44 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 3.14E-06 NA mr1510 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 9.43E-08 8.60E-60 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 6.37E-06 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 6.75E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 3.04E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.90E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.03E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 2.06E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.53E-34 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.99E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 8.94E-13 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 3.30E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 8.99E-48 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 2.52E-69 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 3.59E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 7.57E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 6.60E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.29E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773 NA 1.02E-33 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251