Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020835773:

Variant ID: vg1020835773 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20835773
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGTGGTCTTTAGCTGGGGTTGCCGCTTTTGGGGATTTCTAGAGAGTGTAACGTGGCTCTGTCCCTTCTCACTTCCCACTGTTAGAAGTTGCGTTTAGC[C/T]
GCCGTAGTAGTTTTTTTCCCTAAGCTTCAGTTTCTGTTTTGCTTTTTCTCTATTCCCTTGGAATAAGCCGGTCTGGAGGATTGTATTGTGTAACAAAAAC

Reverse complement sequence

GTTTTTGTTACACAATACAATCCTCCAGACCGGCTTATTCCAAGGGAATAGAGAAAAAGCAAAACAGAAACTGAAGCTTAGGGAAAAAAACTACTACGGC[G/A]
GCTAAACGCAACTTCTAACAGTGGGAAGTGAGAAGGGACAGAGCCACGTTACACTCTCTAGAAATCCCCAAAAGCGGCAACCCCAGCTAAAGACCACATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.20%	37.50%	0.32%	0.00%	NA
All Indica	2759	95.10%	4.60%	0.29%	0.00%	NA
All Japonica	1512	3.60%	95.90%	0.46%	0.00%	NA
Aus	269	52.40%	47.60%	0.00%	0.00%	NA
Indica I	595	99.20%	0.30%	0.50%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	93.10%	6.90%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	6.50%	0.51%	0.00%	NA
Temperate Japonica	767	2.20%	97.00%	0.78%	0.00%	NA
Tropical Japonica	504	4.80%	95.00%	0.20%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020835773	C -> T	LOC_Os10g39080.1	upstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg1020835773	C -> T	LOC_Os10g39084.1	downstream_gene_variant ; 1913.0bp to feature; MODIFIER	silent_mutation	Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg1020835773	C -> T	LOC_Os10g39090.1	downstream_gene_variant ; 1661.0bp to feature; MODIFIER	silent_mutation	Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg1020835773	C -> T	LOC_Os10g39090.2	downstream_gene_variant ; 1662.0bp to feature; MODIFIER	silent_mutation	Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg1020835773	C -> T	LOC_Os10g39084-LOC_Os10g39090	intergenic_region ; MODIFIER	silent_mutation	Average:46.472; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020835773	NA	4.90E-21	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	2.65E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	2.77E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	2.35E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	4.52E-44	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	3.14E-06	NA	mr1510	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	9.43E-08	8.60E-60	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	6.37E-06	mr1558	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	6.75E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	3.04E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.90E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.03E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	2.06E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.53E-34	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.99E-18	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	8.94E-13	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	3.30E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	8.99E-48	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	2.52E-69	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	3.59E-17	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	7.57E-19	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	6.60E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.29E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020835773	NA	1.02E-33	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251