\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020829960:

Variant ID: vg1020829960 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20829960
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGCCCATAAACAGCTGTAAGTAGGAAGGTGGTCTGACATTCTTTTAAGGAGACTGTGGCCGAAAGTGAGAATGTTCCTTGCACAAAGTCTTTGAGCTC[G/A]
GCAAAATCCTCATTCCAGAGGATCAGGATGCCACCTCTTGTTCCTAGCGGTCCTGTCGCTGGCTTGAAGTGAAAAGATTTTAGGCGTCCCCCGCCAAGGG

Reverse complement sequence

CCCTTGGCGGGGGACGCCTAAAATCTTTTCACTTCAAGCCAGCGACAGGACCGCTAGGAACAAGAGGTGGCATCCTGATCCTCTGGAATGAGGATTTTGC[C/T]
GAGCTCAAAGACTTTGTGCAAGGAACATTCTCACTTTCGGCCACAGTCTCCTTAAAAGAATGTCAGACCACCTTCCTACTTACAGCTGTTTATGGGCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.80% 0.00% 0.30% NA
All Indica  2759 98.90% 0.70% 0.00% 0.36% NA
All Japonica  1512 3.60% 96.20% 0.00% 0.26% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 99.20% 0.20% 0.00% 0.67% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 99.60% 0.20% 0.00% 0.22% NA
Indica Intermediate  786 98.10% 1.50% 0.00% 0.38% NA
Temperate Japonica  767 1.80% 98.00% 0.00% 0.13% NA
Tropical Japonica  504 5.00% 94.60% 0.00% 0.40% NA
Japonica Intermediate  241 6.20% 93.40% 0.00% 0.41% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020829960 G -> A LOC_Os10g39070.1 upstream_gene_variant ; 2691.0bp to feature; MODIFIER silent_mutation Average:27.102; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1020829960 G -> A LOC_Os10g39084.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:27.102; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1020829960 G -> A LOC_Os10g39080.1 intron_variant ; MODIFIER silent_mutation Average:27.102; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg1020829960 G -> DEL N N silent_mutation Average:27.102; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020829960 2.28E-07 NA mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 3.87E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 9.08E-06 NA mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 9.01E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.42E-14 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 7.04E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 4.74E-44 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 9.99E-06 6.79E-60 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 4.53E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.15E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.30E-24 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.04E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.92E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 4.08E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.20E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 5.49E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.13E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.74E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 4.89E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.82E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.15E-47 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 5.44E-07 4.87E-76 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.58E-17 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 5.16E-20 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 6.79E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.91E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 5.42E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.63E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 2.36E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020829960 NA 1.72E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251