\
| Variant ID: vg1020772860 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20772860 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTGTGGCTAGAGCTTCGGCCCAGTAAGGAGGCATGGATGCTTGTATGAGTAGGGTGCGAATGGAATTGTTGATTGTGCGAAGCATGCGTTCGGCTTTGC[T/C]
GTTTTGAGGAGAAGTGTAAGGACAGGATAAGCGAAGCAAGGTTCCACGGCTAGCGAGAAACGAGGTAGTGGCTTGGTTAACAAATTCGGTACCATTATCC
GGATAATGGTACCGAATTTGTTAACCAAGCCACTACCTCGTTTCTCGCTAGCCGTGGAACCTTGCTTCGCTTATCCTGTCCTTACACTTCTCCTCAAAAC[A/G]
GCAAAGCCGAACGCATGCTTCGCACAATCAACAATTCCATTCGCACCCTACTCATACAAGCATCCATGCCTCCTTACTGGGCCGAAGCTCTAGCCACAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.60% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 3.90% | 95.60% | 0.53% | 0.00% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 4.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 96.50% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020772860 | T -> C | LOC_Os10g38970.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.705; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020772860 | NA | 1.04E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 2.10E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 1.15E-52 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 8.20E-11 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 5.69E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 2.21E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 2.26E-12 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 6.69E-16 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 1.04E-18 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 1.53E-43 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 5.05E-67 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 4.49E-19 | mr1578_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 4.83E-20 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 4.06E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020772860 | NA | 8.76E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |