\
| Variant ID: vg1020767761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20767761 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 331. )
GTCAGACCAACAATCTTTGTGTGATGGCTCTGATCCTTATTTAGACTTAGCCTAAATTTGATATAATGCTAAATTATTGTCAACAGATACTATACAAACT[T/A]
CTCCCTGGCCACTCCCACGATGATTAATGTTGGTACTTTTACTATTAGATAGCAATATTCTTGCTTGATCGAATTGTATTTATTTAAGCACTTTGCGTCA
TGACGCAAAGTGCTTAAATAAATACAATTCGATCAAGCAAGAATATTGCTATCTAATAGTAAAAGTACCAACATTAATCATCGTGGGAGTGGCCAGGGAG[A/T]
AGTTTGTATAGTATCTGTTGACAATAATTTAGCATTATATCAAATTTAGGCTAAGTCTAAATAAGGATCAGAGCCATCACACAAAGATTGTTGGTCTGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 1.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 96.10% | 3.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020767761 | T -> A | LOC_Os10g38970.1 | upstream_gene_variant ; 730.0bp to feature; MODIFIER | silent_mutation | Average:57.287; most accessible tissue: Callus, score: 89.987 | N | N | N | N |
| vg1020767761 | T -> A | LOC_Os10g38960.1 | downstream_gene_variant ; 1579.0bp to feature; MODIFIER | silent_mutation | Average:57.287; most accessible tissue: Callus, score: 89.987 | N | N | N | N |
| vg1020767761 | T -> A | LOC_Os10g38960-LOC_Os10g38970 | intergenic_region ; MODIFIER | silent_mutation | Average:57.287; most accessible tissue: Callus, score: 89.987 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020767761 | NA | 3.23E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 7.29E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 2.58E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 1.88E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 2.31E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 9.23E-07 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 5.57E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | 3.09E-06 | 3.08E-06 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020767761 | NA | 5.57E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |