Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020767761:

Variant ID: vg1020767761 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20767761
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAGACCAACAATCTTTGTGTGATGGCTCTGATCCTTATTTAGACTTAGCCTAAATTTGATATAATGCTAAATTATTGTCAACAGATACTATACAAACT[T/A]
CTCCCTGGCCACTCCCACGATGATTAATGTTGGTACTTTTACTATTAGATAGCAATATTCTTGCTTGATCGAATTGTATTTATTTAAGCACTTTGCGTCA

Reverse complement sequence

TGACGCAAAGTGCTTAAATAAATACAATTCGATCAAGCAAGAATATTGCTATCTAATAGTAAAAGTACCAACATTAATCATCGTGGGAGTGGCCAGGGAG[A/T]
AGTTTGTATAGTATCTGTTGACAATAATTTAGCATTATATCAAATTTAGGCTAAGTCTAAATAAGGATCAGAGCCATCACACAAAGATTGTTGGTCTGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.60%	1.30%	0.08%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	96.10%	3.70%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	89.50%	10.10%	0.40%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020767761	T -> A	LOC_Os10g38970.1	upstream_gene_variant ; 730.0bp to feature; MODIFIER	silent_mutation	Average:57.287; most accessible tissue: Callus, score: 89.987	N	N	N	N
vg1020767761	T -> A	LOC_Os10g38960.1	downstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:57.287; most accessible tissue: Callus, score: 89.987	N	N	N	N
vg1020767761	T -> A	LOC_Os10g38960-LOC_Os10g38970	intergenic_region ; MODIFIER	silent_mutation	Average:57.287; most accessible tissue: Callus, score: 89.987	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020767761	NA	3.23E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	7.29E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	2.58E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	1.88E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	2.31E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	9.23E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	5.57E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	3.09E-06	3.08E-06	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020767761	NA	5.57E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251