Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020750336:

Variant ID: vg1020750336 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20750336
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGATATGCTGCTGGAATCGGTTGAAATCTATTTGTAACTCCACTTTCTCATTTCCCATCATATATGTGTGCATTGCTGAAAGTGATGTGAAGAGGGGA[G/A]
TAGATAGCGTGTAGCCTGGCAGACTATGGATCATTGGATTGCATCTATGTTTCCGATGGTCTTGCGGGTTTGAGACTTTGAGCTTGAGAATGTATTTCTA

Reverse complement sequence

TAGAAATACATTCTCAAGCTCAAAGTCTCAAACCCGCAAGACCATCGGAAACATAGATGCAATCCAATGATCCATAGTCTGCCAGGCTACACGCTATCTA[C/T]
TCCCCTCTTCACATCACTTTCAGCAATGCACACATATATGATGGGAAATGAGAAAGTGGAGTTACAAATAGATTTCAACCGATTCCAGCAGCATATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.80%	0.34%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.11%	0.00%	NA
All Japonica	1512	4.10%	95.10%	0.79%	0.00%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	98.00%	1.70%	0.34%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.50%	0.13%	0.00%	NA
Temperate Japonica	767	2.20%	96.20%	1.56%	0.00%	NA
Tropical Japonica	504	6.00%	94.00%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020750336	G -> A	LOC_Os10g38940.1	downstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:21.65; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg1020750336	G -> A	LOC_Os10g38940-LOC_Os10g38950	intergenic_region ; MODIFIER	silent_mutation	Average:21.65; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020750336	6.41E-06	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	1.51E-06	NA	mr1014	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	4.49E-06	NA	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.59E-21	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	9.97E-06	2.89E-15	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.05E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.53E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.42E-15	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	7.24E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.50E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.19E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.37E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	4.79E-22	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.37E-44	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.97E-57	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.67E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.14E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	6.43E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	8.95E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	9.78E-07	2.50E-15	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.57E-26	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.76E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.55E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	7.95E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	5.80E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.62E-18	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	2.08E-06	7.24E-18	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.36E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	1.45E-07	2.42E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.61E-19	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.75E-45	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	3.76E-06	6.39E-72	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.21E-17	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.43E-20	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	1.25E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	3.57E-34	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020750336	NA	2.29E-15	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251