\
| Variant ID: vg1020747009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20747009 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTGTGCAACCCGGCGATTGTTTAGTCGCCGGCTTATTCTCTTTTCGCTCTTCTCTCTGCGCTAGCTCAGCGTCCAAGCCAACGTGGCATTTTTATCGCC[A/G,T]
GCTTTCGTAGCTTATTGTACCTGCTCTTAGTTGGGTGACTGACTGTTTCTTTTATCAGAGTTAACTTTTTTTTTTTGGAATGTGCATCATGTTATCTTTC
GAAAGATAACATGATGCACATTCCAAAAAAAAAAAGTTAACTCTGATAAAAGAAACAGTCAGTCACCCAACTAAGAGCAGGTACAATAAGCTACGAAAGC[T/C,A]
GGCGATAAAAATGCCACGTTGGCTTGGACGCTGAGCTAGCGCAGAGAGAAGAGCGAAAAGAGAATAAGCCGGCGACTAAACAATCGCCGGGTTGCACACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 34.70% | 0.11% | 0.00% | T: 0.02% |
| All Indica | 2759 | 98.70% | 1.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 4.90% | 94.80% | 0.26% | 0.00% | T: 0.07% |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 95.70% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.40% | 0.00% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020747009 | A -> G | LOC_Os10g38940.1 | downstream_gene_variant ; 563.0bp to feature; MODIFIER | silent_mutation | Average:60.254; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1020747009 | A -> G | LOC_Os10g38940-LOC_Os10g38950 | intergenic_region ; MODIFIER | silent_mutation | Average:60.254; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1020747009 | A -> T | LOC_Os10g38940.1 | downstream_gene_variant ; 563.0bp to feature; MODIFIER | silent_mutation | Average:60.254; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1020747009 | A -> T | LOC_Os10g38940-LOC_Os10g38950 | intergenic_region ; MODIFIER | silent_mutation | Average:60.254; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020747009 | NA | 5.60E-21 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 4.40E-06 | 2.84E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 3.31E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 3.51E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.10E-15 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 4.02E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 6.56E-28 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.13E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.24E-21 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.10E-43 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 9.52E-06 | NA | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 7.40E-57 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.62E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.55E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 9.46E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.01E-20 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 3.02E-07 | 1.83E-15 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.06E-25 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.24E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.56E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.38E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 4.42E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 4.25E-18 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 3.37E-07 | 2.92E-18 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 9.83E-06 | NA | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.05E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | 4.55E-08 | 2.72E-17 | mr1995 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 3.93E-19 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 7.34E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 8.61E-46 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.81E-70 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 4.34E-17 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.08E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.83E-19 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 2.41E-17 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.77E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.70E-33 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020747009 | NA | 1.82E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |