\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020743112:

Variant ID: vg1020743112 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20743112
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCCGATTTCCAATCTCCCATCCACGTCACGACATCACCACTTCACCAGGTGTCCCATGTCAATTCCTCGAGCTACTTCTTCCGTCCAAAAAAAAAA[T/C,A]
AAATCTTGAGTTTCCGTATCTAACGTTTAATTGTCCGTCTTATATGAAATTATTTATAATTAGTATTTTCATTGTTGTTAGATGATAAAACATGATTAAT

Reverse complement sequence

ATTAATCATGTTTTATCATCTAACAACAATGAAAATACTAATTATAAATAATTTCATATAAGACGGACAATTAAACGTTAGATACGGAAACTCAAGATTT[A/G,T]
TTTTTTTTTTGGACGGAAGAAGTAGCTCGAGGAATTGACATGGGACACCTGGTGAAGTGGTGATGTCGTGACGTGGATGGGAGATTGGAAATCGGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 24.10% 3.66% 3.89% A: 0.80%
All Indica  2759 87.60% 0.90% 3.84% 6.38% A: 1.27%
All Japonica  1512 25.70% 70.70% 3.51% 0.07% NA
Aus  269 95.50% 0.70% 2.60% 0.74% A: 0.37%
Indica I  595 91.30% 1.70% 3.03% 3.53% A: 0.50%
Indica II  465 76.60% 1.10% 7.10% 12.47% A: 2.80%
Indica III  913 92.60% 0.30% 1.53% 4.38% A: 1.20%
Indica Intermediate  786 85.60% 0.90% 5.22% 7.25% A: 1.02%
Temperate Japonica  767 23.30% 71.20% 5.35% 0.13% NA
Tropical Japonica  504 17.10% 81.70% 1.19% 0.00% NA
Japonica Intermediate  241 51.50% 46.10% 2.49% 0.00% NA
VI/Aromatic  96 81.20% 13.50% 5.21% 0.00% NA
Intermediate  90 57.80% 32.20% 2.22% 5.56% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020743112 T -> C LOC_Os10g38940.1 upstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> C LOC_Os10g38930.1 downstream_gene_variant ; 4799.0bp to feature; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> C LOC_Os10g38930-LOC_Os10g38940 intergenic_region ; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> A LOC_Os10g38940.1 upstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> A LOC_Os10g38930.1 downstream_gene_variant ; 4799.0bp to feature; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> A LOC_Os10g38930-LOC_Os10g38940 intergenic_region ; MODIFIER silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N
vg1020743112 T -> DEL N N silent_mutation Average:58.055; most accessible tissue: Zhenshan97 flower, score: 86.194 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020743112 T A 0.0 0.01 0.02 -0.02 0.01 0.01
vg1020743112 T C -0.03 -0.04 -0.03 -0.04 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020743112 6.68E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 1.74E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 6.68E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 2.56E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 2.22E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 1.85E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 2.02E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 7.87E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 1.66E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 1.08E-06 NA mr1618 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 1.56E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 1.48E-08 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 2.08E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 9.06E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 9.44E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 7.85E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020743112 NA 2.74E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251