\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020742613:

Variant ID: vg1020742613 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20742613
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTCTTCATTAGAGTTCACATGAAAAAATTATGAATTATTTTTAAATATAAAGTCTTTAGACCATTCTATTTAACCTAGATGATATTCAAATCCAAGTTT[A/G]
GGGACCGGGGTGACACAACTGAACAAGTTGGAGGAGCTAAACGAGTGATCTGCAAGTTTAGGGAACGGGATGACACAGTCGAACAAGTTTGAGTACCTAA

Reverse complement sequence

TTAGGTACTCAAACTTGTTCGACTGTGTCATCCCGTTCCCTAAACTTGCAGATCACTCGTTTAGCTCCTCCAACTTGTTCAGTTGTGTCACCCCGGTCCC[T/C]
AAACTTGGATTTGAATATCATCTAGGTTAAATAGAATGGTCTAAAGACTTTATATTTAAAAATAATTCATAATTTTTTCATGTGAACTCTAATGAAGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 35.60% 0.47% 0.15% NA
All Indica  2759 97.40% 1.80% 0.62% 0.25% NA
All Japonica  1512 3.90% 96.00% 0.07% 0.00% NA
Aus  269 53.90% 45.00% 1.12% 0.00% NA
Indica I  595 97.50% 1.80% 0.34% 0.34% NA
Indica II  465 97.40% 1.50% 1.08% 0.00% NA
Indica III  913 98.50% 0.90% 0.44% 0.22% NA
Indica Intermediate  786 95.90% 2.90% 0.76% 0.38% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 6.00% 94.00% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020742613 A -> G LOC_Os10g38940.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:40.286; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1020742613 A -> G LOC_Os10g38930.1 downstream_gene_variant ; 4300.0bp to feature; MODIFIER silent_mutation Average:40.286; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1020742613 A -> G LOC_Os10g38930-LOC_Os10g38940 intergenic_region ; MODIFIER silent_mutation Average:40.286; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1020742613 A -> DEL N N silent_mutation Average:40.286; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020742613 5.19E-06 NA mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 3.31E-22 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 6.03E-06 NA mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 7.93E-06 NA mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 2.98E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.29E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.30E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 9.07E-06 1.77E-23 mr1477 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 2.98E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.38E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 2.85E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 2.76E-54 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.44E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.74E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 4.78E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 6.35E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 4.32E-14 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.55E-48 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 3.60E-06 2.77E-69 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 1.52E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020742613 NA 2.17E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251