\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020723356:

Variant ID: vg1020723356 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20723356
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTAATAGATTGATACATATTTTTTAAAATTTAACTTTCACACAAATGCTCTCACGTAGACCCTACAAACCATGTTTCTATCGGTCGATGTTGCCCTATCT[C/T]
CCTATCTTACCTAGGAGTGTGCTTGGATCCAATGGCAAATTAATCGCCCGCGCTTATATATTTCTCTTCCAACTCATCATTCTTTCTTCATGCATGCATT

Reverse complement sequence

AATGCATGCATGAAGAAAGAATGATGAGTTGGAAGAGAAATATATAAGCGCGGGCGATTAATTTGCCATTGGATCCAAGCACACTCCTAGGTAAGATAGG[G/A]
AGATAGGGCAACATCGACCGATAGAAACATGGTTTGTAGGGTCTACGTGAGAGCATTTGTGTGAAAGTTAAATTTTAAAAAATATGTATCAATCTATTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.80% 0.02% 0.11% NA
All Indica  2759 98.20% 1.70% 0.04% 0.14% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.07% NA
Aus  269 29.40% 70.60% 0.00% 0.00% NA
Indica I  595 98.00% 1.70% 0.17% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 96.40% 3.30% 0.00% 0.25% NA
Temperate Japonica  767 1.80% 98.00% 0.00% 0.13% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020723356 C -> T LOC_Os10g38890.1 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:61.791; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1020723356 C -> T LOC_Os10g38900.1 upstream_gene_variant ; 1695.0bp to feature; MODIFIER silent_mutation Average:61.791; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1020723356 C -> T LOC_Os10g38890-LOC_Os10g38900 intergenic_region ; MODIFIER silent_mutation Average:61.791; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1020723356 C -> DEL N N silent_mutation Average:61.791; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020723356 C T 0.0 -0.02 -0.03 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020723356 NA 5.37E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 9.97E-55 mr1063 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.34E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 2.90E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 4.40E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.36E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 4.63E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 3.02E-07 3.14E-53 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 1.13E-08 1.16E-62 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 5.14E-25 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 3.29E-23 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 2.32E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.16E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 4.55E-31 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.84E-19 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.39E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 1.57E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 2.29E-09 2.95E-59 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 3.26E-11 2.43E-78 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020723356 NA 9.95E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251