\
| Variant ID: vg1020720683 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20720683 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 250. )
AATAGAGACACAGAGACTGAATTGAGCATCCCTTTTCAAACAAGAGTTTACATGGGAATTTATATTTCATTTTATCATCCCGGGGCAGCTCTAGGGTGAG[C/T]
TCCTCGATCCCAGGGATAGCTGCATCAAGCCAATGGTTGATATGATGGGCAGACAACTCATGAAAAAATTGTAGTTCAAACCTAAACCTCTTCACCCAAC
GTTGGGTGAAGAGGTTTAGGTTTGAACTACAATTTTTTCATGAGTTGTCTGCCCATCATATCAACCATTGGCTTGATGCAGCTATCCCTGGGATCGAGGA[G/A]
CTCACCCTAGAGCTGCCCCGGGATGATAAAATGAAATATAAATTCCCATGTAAACTCTTGTTTGAAAAGGGATGCTCAATTCAGTCTCTGTGTCTCTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.70% | 4.10% | 0.55% | 59.63% | NA |
| All Indica | 2759 | 2.20% | 1.00% | 0.58% | 96.23% | NA |
| All Japonica | 1512 | 96.00% | 0.70% | 0.20% | 3.11% | NA |
| Aus | 269 | 43.90% | 27.50% | 0.74% | 27.88% | NA |
| Indica I | 595 | 2.90% | 0.80% | 0.84% | 95.46% | NA |
| Indica II | 465 | 1.30% | 0.40% | 0.43% | 97.85% | NA |
| Indica III | 913 | 1.00% | 0.20% | 0.33% | 98.47% | NA |
| Indica Intermediate | 786 | 3.60% | 2.40% | 0.76% | 93.26% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 93.50% | 0.80% | 0.40% | 5.36% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.50% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 19.80% | 75.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 42.20% | 12.20% | 4.44% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020720683 | C -> T | LOC_Os10g38890.1 | synonymous_variant ; p.Glu94Glu; LOW | synonymous_codon | Average:30.41; most accessible tissue: Callus, score: 65.274 | N | N | N | N |
| vg1020720683 | C -> DEL | LOC_Os10g38890.1 | N | frameshift_variant | Average:30.41; most accessible tissue: Callus, score: 65.274 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020720683 | NA | 2.36E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 5.54E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 5.13E-29 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 2.16E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.10E-46 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | 8.45E-06 | NA | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | 2.16E-08 | 8.83E-63 | mr1558 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.51E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 8.35E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 3.60E-26 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 3.35E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 4.36E-29 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 3.54E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 2.78E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 3.18E-21 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.04E-16 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 4.89E-19 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.19E-47 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | 3.47E-06 | 1.76E-72 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 4.79E-17 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 6.74E-20 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.99E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.38E-19 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 1.32E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020720683 | NA | 5.77E-15 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |