\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020599607:

Variant ID: vg1020599607 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20599607
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAATTTAAACAGAGGTAAAACATGCAAAAATCTATTCAAAGTTCTATTGAAATTTGCATGAAAAATTGACAAAATAAAATGGAAAAATTGCTACTGTT[A/C]
TCTTTTATTCATTTTCGGCCCCCGAGGGACCTCATATGGACTTTTTCCGGTCGGCCCGCGGCCTTTTTGGCTCGCGCGGGTGCTCCCCCCTCCCCCCAGG

Reverse complement sequence

CCTGGGGGGAGGGGGGAGCACCCGCGCGAGCCAAAAAGGCCGCGGGCCGACCGGAAAAAGTCCATATGAGGTCCCTCGGGGGCCGAAAATGAATAAAAGA[T/G]
AACAGTAGCAATTTTTCCATTTTATTTTGTCAATTTTTCATGCAAATTTCAATAGAACTTTGAATAGATTTTTGCATGTTTTACCTCTGTTTAAATTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.50% 0.25% 0.00% NA
All Indica  2759 98.20% 1.60% 0.18% 0.00% NA
All Japonica  1512 8.50% 91.50% 0.00% 0.00% NA
Aus  269 56.50% 43.10% 0.37% 0.00% NA
Indica I  595 96.60% 2.90% 0.50% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 6.20% 3.12% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020599607 A -> C LOC_Os10g38630.1 upstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N
vg1020599607 A -> C LOC_Os10g38640.1 upstream_gene_variant ; 4153.0bp to feature; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N
vg1020599607 A -> C LOC_Os10g38630.2 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N
vg1020599607 A -> C LOC_Os10g38600.1 downstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N
vg1020599607 A -> C LOC_Os10g38610.1 downstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N
vg1020599607 A -> C LOC_Os10g38610-LOC_Os10g38630 intergenic_region ; MODIFIER silent_mutation Average:33.082; most accessible tissue: Callus, score: 82.835 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020599607 2.42E-06 2.62E-47 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 1.02E-07 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 3.91E-11 5.71E-64 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 3.48E-06 1.66E-09 mr1558 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 8.55E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 3.08E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 2.46E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 2.01E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 5.39E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 3.31E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 2.14E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 3.93E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 1.43E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 1.86E-08 1.92E-54 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 3.23E-07 3.28E-11 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 8.21E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 7.98E-19 2.68E-90 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 1.42E-11 2.89E-19 mr1558_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 2.69E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 1.07E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 6.97E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 2.17E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 1.39E-20 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 3.27E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 6.43E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607 NA 1.55E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251