Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020599607:

Variant ID: vg1020599607 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20599607
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAATTTAAACAGAGGTAAAACATGCAAAAATCTATTCAAAGTTCTATTGAAATTTGCATGAAAAATTGACAAAATAAAATGGAAAAATTGCTACTGTT[A/C]
TCTTTTATTCATTTTCGGCCCCCGAGGGACCTCATATGGACTTTTTCCGGTCGGCCCGCGGCCTTTTTGGCTCGCGCGGGTGCTCCCCCCTCCCCCCAGG

Reverse complement sequence

CCTGGGGGGAGGGGGGAGCACCCGCGCGAGCCAAAAAGGCCGCGGGCCGACCGGAAAAAGTCCATATGAGGTCCCTCGGGGGCCGAAAATGAATAAAAGA[T/G]
AACAGTAGCAATTTTTCCATTTTATTTTGTCAATTTTTCATGCAAATTTCAATAGAACTTTGAATAGATTTTTGCATGTTTTACCTCTGTTTAAATTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	33.50%	0.25%	0.00%	NA
All Indica	2759	98.20%	1.60%	0.18%	0.00%	NA
All Japonica	1512	8.50%	91.50%	0.00%	0.00%	NA
Aus	269	56.50%	43.10%	0.37%	0.00%	NA
Indica I	595	96.60%	2.90%	0.50%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	19.20%	80.80%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	6.20%	3.12%	0.00%	NA
Intermediate	90	62.20%	34.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020599607	A -> C	LOC_Os10g38630.1	upstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1020599607	A -> C	LOC_Os10g38640.1	upstream_gene_variant ; 4153.0bp to feature; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1020599607	A -> C	LOC_Os10g38630.2	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1020599607	A -> C	LOC_Os10g38600.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1020599607	A -> C	LOC_Os10g38610.1	downstream_gene_variant ; 1221.0bp to feature; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1020599607	A -> C	LOC_Os10g38610-LOC_Os10g38630	intergenic_region ; MODIFIER	silent_mutation	Average:33.082; most accessible tissue: Callus, score: 82.835	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020599607	2.42E-06	2.62E-47	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	1.02E-07	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	3.91E-11	5.71E-64	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	3.48E-06	1.66E-09	mr1558	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	8.55E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	3.08E-11	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	2.46E-23	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	2.01E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	5.39E-16	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	3.31E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	2.14E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	3.93E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	1.43E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	1.86E-08	1.92E-54	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	3.23E-07	3.28E-11	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	8.21E-15	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	7.98E-19	2.68E-90	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	1.42E-11	2.89E-19	mr1558_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	2.69E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	1.07E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	6.97E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	2.17E-21	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	1.39E-20	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	3.27E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	6.43E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599607	NA	1.55E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251