\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020599205:

Variant ID: vg1020599205 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20599205
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACTTTGCTCTAGGATCACCTAGGTTAGATCTCCTTTTAGGGTCGGAATATCTTTAATGCAACCCATCAAGGAGGAGCCACCTGAAATAATCATGTGCG[G/A]
TGAGAACAAAATTAACATTAAAATATTATGCATTAAGCCTATATCACCGTTGGGCAGAATTAGACATAACACATATCACCATAACTATAATATTGCAATT

Reverse complement sequence

AATTGCAATATTATAGTTATGGTGATATGTGTTATGTCTAATTCTGCCCAACGGTGATATAGGCTTAATGCATAATATTTTAATGTTAATTTTGTTCTCA[C/T]
CGCACATGATTATTTCAGGTGGCTCCTCCTTGATGGGTTGCATTAAAGATATTCCGACCCTAAAAGGAGATCTAACCTAGGTGATCCTAGAGCAAAGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.80% 0.15% 0.00% NA
All Indica  2759 97.90% 1.90% 0.18% 0.00% NA
All Japonica  1512 8.50% 91.50% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 96.60% 2.90% 0.50% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.70% 0.25% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020599205 G -> A LOC_Os10g38630.1 upstream_gene_variant ; 1578.0bp to feature; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599205 G -> A LOC_Os10g38640.1 upstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599205 G -> A LOC_Os10g38630.2 upstream_gene_variant ; 667.0bp to feature; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599205 G -> A LOC_Os10g38600.1 downstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599205 G -> A LOC_Os10g38610.1 downstream_gene_variant ; 819.0bp to feature; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599205 G -> A LOC_Os10g38610-LOC_Os10g38630 intergenic_region ; MODIFIER silent_mutation Average:28.201; most accessible tissue: Callus, score: 59.45 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020599205 3.77E-07 7.74E-44 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 1.72E-07 1.08E-09 mr1509 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 1.49E-07 1.47E-53 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 9.61E-08 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 1.38E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 2.23E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 5.41E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 1.57E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 1.60E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 1.50E-06 2.67E-62 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 2.98E-06 1.55E-12 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 7.54E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 1.24E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 2.57E-18 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205 NA 3.41E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251