Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020599205:

Variant ID: vg1020599205 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20599205
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACTTTGCTCTAGGATCACCTAGGTTAGATCTCCTTTTAGGGTCGGAATATCTTTAATGCAACCCATCAAGGAGGAGCCACCTGAAATAATCATGTGCG[G/A]
TGAGAACAAAATTAACATTAAAATATTATGCATTAAGCCTATATCACCGTTGGGCAGAATTAGACATAACACATATCACCATAACTATAATATTGCAATT

Reverse complement sequence

AATTGCAATATTATAGTTATGGTGATATGTGTTATGTCTAATTCTGCCCAACGGTGATATAGGCTTAATGCATAATATTTTAATGTTAATTTTGTTCTCA[C/T]
CGCACATGATTATTTCAGGTGGCTCCTCCTTGATGGGTTGCATTAAAGATATTCCGACCCTAAAAGGAGATCTAACCTAGGTGATCCTAGAGCAAAGTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.80%	0.15%	0.00%	NA
All Indica	2759	97.90%	1.90%	0.18%	0.00%	NA
All Japonica	1512	8.50%	91.50%	0.00%	0.00%	NA
Aus	269	56.10%	43.90%	0.00%	0.00%	NA
Indica I	595	96.60%	2.90%	0.50%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.70%	0.25%	0.00%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	19.40%	80.60%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020599205	G -> A	LOC_Os10g38630.1	upstream_gene_variant ; 1578.0bp to feature; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N
vg1020599205	G -> A	LOC_Os10g38640.1	upstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N
vg1020599205	G -> A	LOC_Os10g38630.2	upstream_gene_variant ; 667.0bp to feature; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N
vg1020599205	G -> A	LOC_Os10g38600.1	downstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N
vg1020599205	G -> A	LOC_Os10g38610.1	downstream_gene_variant ; 819.0bp to feature; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N
vg1020599205	G -> A	LOC_Os10g38610-LOC_Os10g38630	intergenic_region ; MODIFIER	silent_mutation	Average:28.201; most accessible tissue: Callus, score: 59.45	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020599205	3.77E-07	7.74E-44	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	1.72E-07	1.08E-09	mr1509	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	1.49E-07	1.47E-53	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	9.61E-08	mr1558	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	1.38E-13	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	2.23E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	5.41E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	1.57E-16	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	1.60E-08	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	1.50E-06	2.67E-62	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	2.98E-06	1.55E-12	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	7.54E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	1.24E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	2.57E-18	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599205	NA	3.41E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251