\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020599180:

Variant ID: vg1020599180 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20599180
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTCACGATTACTTGTAAATGTTAGACTTTGCTCTAGGATCACCTAGGTTAGATCTCCTTTTAGGGTCGGAATATCTTTAATGCAACCCATCAAGGAG[G/T]
AGCCACCTGAAATAATCATGTGCGGTGAGAACAAAATTAACATTAAAATATTATGCATTAAGCCTATATCACCGTTGGGCAGAATTAGACATAACACATA

Reverse complement sequence

TATGTGTTATGTCTAATTCTGCCCAACGGTGATATAGGCTTAATGCATAATATTTTAATGTTAATTTTGTTCTCACCGCACATGATTATTTCAGGTGGCT[C/A]
CTCCTTGATGGGTTGCATTAAAGATATTCCGACCCTAAAAGGAGATCTAACCTAGGTGATCCTAGAGCAAAGTCTAACATTTACAAGTAATCGTGACATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.10% 0.57% 0.00% NA
All Indica  2759 98.90% 1.00% 0.14% 0.00% NA
All Japonica  1512 43.20% 55.50% 1.32% 0.00% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.80% 0.13% 0.00% NA
Temperate Japonica  767 14.50% 83.20% 2.35% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 61.40% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020599180 G -> T LOC_Os10g38630.1 upstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599180 G -> T LOC_Os10g38640.1 upstream_gene_variant ; 4580.0bp to feature; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599180 G -> T LOC_Os10g38630.2 upstream_gene_variant ; 692.0bp to feature; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599180 G -> T LOC_Os10g38600.1 downstream_gene_variant ; 3064.0bp to feature; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599180 G -> T LOC_Os10g38610.1 downstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N
vg1020599180 G -> T LOC_Os10g38610-LOC_Os10g38630 intergenic_region ; MODIFIER silent_mutation Average:32.381; most accessible tissue: Callus, score: 59.45 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020599180 NA 8.90E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 4.01E-06 mr1133 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 1.21E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 9.37E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 2.23E-06 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 1.24E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 2.03E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 2.70E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 2.58E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 3.45E-14 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 2.50E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 3.57E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020599180 NA 2.37E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251