\
| Variant ID: vg1020599180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20599180 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGTCACGATTACTTGTAAATGTTAGACTTTGCTCTAGGATCACCTAGGTTAGATCTCCTTTTAGGGTCGGAATATCTTTAATGCAACCCATCAAGGAG[G/T]
AGCCACCTGAAATAATCATGTGCGGTGAGAACAAAATTAACATTAAAATATTATGCATTAAGCCTATATCACCGTTGGGCAGAATTAGACATAACACATA
TATGTGTTATGTCTAATTCTGCCCAACGGTGATATAGGCTTAATGCATAATATTTTAATGTTAATTTTGTTCTCACCGCACATGATTATTTCAGGTGGCT[C/A]
CTCCTTGATGGGTTGCATTAAAGATATTCCGACCCTAAAAGGAGATCTAACCTAGGTGATCCTAGAGCAAAGTCTAACATTTACAAGTAATCGTGACATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.10% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 43.20% | 55.50% | 1.32% | 0.00% | NA |
| Aus | 269 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 14.50% | 83.20% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.80% | 61.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020599180 | G -> T | LOC_Os10g38630.1 | upstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| vg1020599180 | G -> T | LOC_Os10g38640.1 | upstream_gene_variant ; 4580.0bp to feature; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| vg1020599180 | G -> T | LOC_Os10g38630.2 | upstream_gene_variant ; 692.0bp to feature; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| vg1020599180 | G -> T | LOC_Os10g38600.1 | downstream_gene_variant ; 3064.0bp to feature; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| vg1020599180 | G -> T | LOC_Os10g38610.1 | downstream_gene_variant ; 794.0bp to feature; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| vg1020599180 | G -> T | LOC_Os10g38610-LOC_Os10g38630 | intergenic_region ; MODIFIER | silent_mutation | Average:32.381; most accessible tissue: Callus, score: 59.45 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020599180 | NA | 8.90E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 4.01E-06 | mr1133 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | 1.21E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 9.37E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | 2.23E-06 | NA | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 1.24E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 2.03E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 2.70E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 2.58E-09 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 3.45E-14 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 2.50E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 3.57E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020599180 | NA | 2.37E-10 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |