\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020583266:

Variant ID: vg1020583266 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20583266
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCGGGAACGTGTCTGATCTTCTTTGATTTGAGGGTGGGGGACTTGGGTAAGTTTTGGCAAGATTGCATTGTCTGACATTGTGGGACATCTTGCATGTC[A/G]
ACTTTTGATGGCAAGGTCTTTCTTTTGTGACAACTTCCTTCTTTAACCATGCTATTTTCTTGCGATACGGATTTATTGATTGAGTTCTGAAGGTTGGGGC

Reverse complement sequence

GCCCCAACCTTCAGAACTCAATCAATAAATCCGTATCGCAAGAAAATAGCATGGTTAAAGAAGGAAGTTGTCACAAAAGAAAGACCTTGCCATCAAAAGT[T/C]
GACATGCAAGATGTCCCACAATGTCAGACAATGCAATCTTGCCAAAACTTACCCAAGTCCCCCACCCTCAAATCAAAGAAGATCAGACACGTTCCCGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 9.00% 14.90% 21.48% NA
All Indica  2759 34.10% 14.50% 21.17% 30.30% NA
All Japonica  1512 92.00% 0.10% 0.66% 7.21% NA
Aus  269 61.30% 5.60% 23.79% 9.29% NA
Indica I  595 21.00% 22.00% 22.02% 34.96% NA
Indica II  465 35.70% 12.90% 20.22% 31.18% NA
Indica III  913 45.90% 12.90% 19.82% 21.36% NA
Indica Intermediate  786 29.30% 11.50% 22.65% 36.64% NA
Temperate Japonica  767 97.70% 0.30% 0.26% 1.83% NA
Tropical Japonica  504 81.50% 0.00% 1.19% 17.26% NA
Japonica Intermediate  241 95.90% 0.00% 0.83% 3.32% NA
VI/Aromatic  96 27.10% 3.10% 36.46% 33.33% NA
Intermediate  90 64.40% 8.90% 12.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020583266 A -> G LOC_Os10g38560.1 synonymous_variant ; p.Val135Val; LOW synonymous_codon Average:12.777; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1020583266 A -> DEL LOC_Os10g38560.1 N frameshift_variant Average:12.777; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020583266 NA 1.90E-16 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 1.27E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 1.22E-16 mr1165 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 2.67E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 6.11E-17 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 3.88E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 1.15E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 5.45E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 2.99E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 2.73E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 5.36E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 6.21E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 8.08E-08 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 7.25E-08 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 7.26E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 3.47E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 9.44E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 3.09E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020583266 NA 6.01E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251