Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020582981:

Variant ID: vg1020582981 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20582981
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTTCTTTTGCTTGGATCCCTAGGGACATTACTTTGCGTCTCTTGTATTCTTGCATCTTTTTCTTTTCTTGGATGTCTTGGCACATGTCACAGGATGC[T/G]
TTTGCTCTTTTGTCATCAGGGAAGGTTGGACGTACTGCATTAACATTTTGCAAATTCGGGCTTCCTTGGGGATAGAAGGGCATCCTTGAGGTGCTCATAT

Reverse complement sequence

ATATGAGCACCTCAAGGATGCCCTTCTATCCCCAAGGAAGCCCGAATTTGCAAAATGTTAATGCAGTACGTCCAACCTTCCCTGATGACAAAAGAGCAAA[A/C]
GCATCCTGTGACATGTGCCAAGACATCCAAGAAAAGAAAAAGATGCAAGAATACAAGAGACGCAAAGTAATGTCCCTAGGGATCCAAGCAAAAGAAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	3.20%	3.26%	29.07%	NA
All Indica	2759	46.60%	5.20%	3.15%	44.98%	NA
All Japonica	1512	93.50%	0.10%	2.71%	3.77%	NA
Aus	269	82.20%	0.00%	7.81%	10.04%	NA
Indica I	595	31.40%	18.70%	3.03%	46.89%	NA
Indica II	465	51.00%	3.70%	3.23%	42.15%	NA
Indica III	913	58.20%	0.00%	2.52%	39.32%	NA
Indica Intermediate	786	42.20%	2.00%	3.94%	51.78%	NA
Temperate Japonica	767	98.30%	0.10%	0.39%	1.17%	NA
Tropical Japonica	504	84.50%	0.00%	7.54%	7.94%	NA
Japonica Intermediate	241	96.70%	0.00%	0.00%	3.32%	NA
VI/Aromatic	96	66.70%	0.00%	2.08%	31.25%	NA
Intermediate	90	71.10%	4.40%	3.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020582981	T -> G	LOC_Os10g38560.1	missense_variant ; p.Lys230Asn; MODERATE	nonsynonymous_codon ; K230N	Average:13.733; most accessible tissue: Minghui63 young leaf, score: 35.334	benign	1.341	TOLERATED	0.15
vg1020582981	T -> DEL	LOC_Os10g38560.1	N	frameshift_variant	Average:13.733; most accessible tissue: Minghui63 young leaf, score: 35.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020582981	NA	3.58E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	3.99E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	9.99E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	8.50E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.34E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.79E-06	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.06E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.23E-08	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	9.43E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.68E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	6.35E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	6.30E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	4.13E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.85E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	3.44E-08	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	3.92E-08	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	6.20E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	3.23E-09	mr1706_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	4.61E-08	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	3.47E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	5.39E-06	mr1921_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.21E-09	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	2.21E-06	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	1.07E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981	NA	2.93E-07	mr1960_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251