\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020582981:

Variant ID: vg1020582981 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20582981
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTTCTTTTGCTTGGATCCCTAGGGACATTACTTTGCGTCTCTTGTATTCTTGCATCTTTTTCTTTTCTTGGATGTCTTGGCACATGTCACAGGATGC[T/G]
TTTGCTCTTTTGTCATCAGGGAAGGTTGGACGTACTGCATTAACATTTTGCAAATTCGGGCTTCCTTGGGGATAGAAGGGCATCCTTGAGGTGCTCATAT

Reverse complement sequence

ATATGAGCACCTCAAGGATGCCCTTCTATCCCCAAGGAAGCCCGAATTTGCAAAATGTTAATGCAGTACGTCCAACCTTCCCTGATGACAAAAGAGCAAA[A/C]
GCATCCTGTGACATGTGCCAAGACATCCAAGAAAAGAAAAAGATGCAAGAATACAAGAGACGCAAAGTAATGTCCCTAGGGATCCAAGCAAAAGAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 3.20% 3.26% 29.07% NA
All Indica  2759 46.60% 5.20% 3.15% 44.98% NA
All Japonica  1512 93.50% 0.10% 2.71% 3.77% NA
Aus  269 82.20% 0.00% 7.81% 10.04% NA
Indica I  595 31.40% 18.70% 3.03% 46.89% NA
Indica II  465 51.00% 3.70% 3.23% 42.15% NA
Indica III  913 58.20% 0.00% 2.52% 39.32% NA
Indica Intermediate  786 42.20% 2.00% 3.94% 51.78% NA
Temperate Japonica  767 98.30% 0.10% 0.39% 1.17% NA
Tropical Japonica  504 84.50% 0.00% 7.54% 7.94% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 66.70% 0.00% 2.08% 31.25% NA
Intermediate  90 71.10% 4.40% 3.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020582981 T -> G LOC_Os10g38560.1 missense_variant ; p.Lys230Asn; MODERATE nonsynonymous_codon ; K230N Average:13.733; most accessible tissue: Minghui63 young leaf, score: 35.334 benign 1.341 TOLERATED 0.15
vg1020582981 T -> DEL LOC_Os10g38560.1 N frameshift_variant Average:13.733; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020582981 NA 3.58E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 3.99E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 9.99E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 8.50E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.34E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.79E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.06E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.23E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 9.43E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.68E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 6.35E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 6.30E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 4.13E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.85E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 3.44E-08 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 3.92E-08 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 6.20E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 3.23E-09 mr1706_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 4.61E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 3.47E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 5.39E-06 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.21E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 2.21E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 1.07E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020582981 NA 2.93E-07 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251