\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020568417:

Variant ID: vg1020568417 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20568417
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGGAATAAGGAATTGATTTATGGAATAGGGGAAAAAGGGTTTATTAAATCCCTTGAAAAAGAAGGGAGGGATGCCATATAGACTTCCTAGGGCGGCT[C/T]
AGGCGCGGCCCGAGGGGTTTATGCGGCTTGGCCGGACCTAATGGGCCGGCGCGGGCACGGGAGGGGCGGCCCAAGAGAGGGGGCGCGGGGAGAGAGAGGC

Reverse complement sequence

GCCTCTCTCTCCCCGCGCCCCCTCTCTTGGGCCGCCCCTCCCGTGCCCGCGCCGGCCCATTAGGTCCGGCCAAGCCGCATAAACCCCTCGGGCCGCGCCT[G/A]
AGCCGCCCTAGGAAGTCTATATGGCATCCCTCCCTTCTTTTTCAAGGGATTTAATAAACCCTTTTTCCCCTATTCCATAAATCAATTCCTTATTCCCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 29.20% 22.83% 1.57% NA
All Indica  2759 61.70% 1.80% 33.89% 2.57% NA
All Japonica  1512 18.20% 77.90% 3.90% 0.00% NA
Aus  269 42.00% 42.80% 14.87% 0.37% NA
Indica I  595 36.50% 3.20% 57.31% 3.03% NA
Indica II  465 51.60% 1.50% 41.94% 4.95% NA
Indica III  913 86.30% 0.40% 12.05% 1.20% NA
Indica Intermediate  786 58.30% 2.50% 36.77% 2.42% NA
Temperate Japonica  767 11.50% 87.20% 1.30% 0.00% NA
Tropical Japonica  504 27.60% 64.30% 8.13% 0.00% NA
Japonica Intermediate  241 19.90% 76.80% 3.32% 0.00% NA
VI/Aromatic  96 70.80% 7.30% 21.88% 0.00% NA
Intermediate  90 37.80% 33.30% 26.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020568417 C -> T LOC_Os10g38510.1 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg1020568417 C -> T LOC_Os10g38520.1 upstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg1020568417 C -> T LOC_Os10g38510-LOC_Os10g38520 intergenic_region ; MODIFIER silent_mutation Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N
vg1020568417 C -> DEL N N silent_mutation Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020568417 NA 1.66E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 1.50E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 5.40E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 1.19E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 4.29E-08 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 1.19E-06 NA mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 2.13E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 4.71E-13 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020568417 NA 7.86E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251