\
| Variant ID: vg1020568417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20568417 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTGGGAATAAGGAATTGATTTATGGAATAGGGGAAAAAGGGTTTATTAAATCCCTTGAAAAAGAAGGGAGGGATGCCATATAGACTTCCTAGGGCGGCT[C/T]
AGGCGCGGCCCGAGGGGTTTATGCGGCTTGGCCGGACCTAATGGGCCGGCGCGGGCACGGGAGGGGCGGCCCAAGAGAGGGGGCGCGGGGAGAGAGAGGC
GCCTCTCTCTCCCCGCGCCCCCTCTCTTGGGCCGCCCCTCCCGTGCCCGCGCCGGCCCATTAGGTCCGGCCAAGCCGCATAAACCCCTCGGGCCGCGCCT[G/A]
AGCCGCCCTAGGAAGTCTATATGGCATCCCTCCCTTCTTTTTCAAGGGATTTAATAAACCCTTTTTCCCCTATTCCATAAATCAATTCCTTATTCCCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.40% | 29.20% | 22.83% | 1.57% | NA |
| All Indica | 2759 | 61.70% | 1.80% | 33.89% | 2.57% | NA |
| All Japonica | 1512 | 18.20% | 77.90% | 3.90% | 0.00% | NA |
| Aus | 269 | 42.00% | 42.80% | 14.87% | 0.37% | NA |
| Indica I | 595 | 36.50% | 3.20% | 57.31% | 3.03% | NA |
| Indica II | 465 | 51.60% | 1.50% | 41.94% | 4.95% | NA |
| Indica III | 913 | 86.30% | 0.40% | 12.05% | 1.20% | NA |
| Indica Intermediate | 786 | 58.30% | 2.50% | 36.77% | 2.42% | NA |
| Temperate Japonica | 767 | 11.50% | 87.20% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 27.60% | 64.30% | 8.13% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.90% | 76.80% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 7.30% | 21.88% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 33.30% | 26.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020568417 | C -> T | LOC_Os10g38510.1 | upstream_gene_variant ; 2177.0bp to feature; MODIFIER | silent_mutation | Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
| vg1020568417 | C -> T | LOC_Os10g38520.1 | upstream_gene_variant ; 702.0bp to feature; MODIFIER | silent_mutation | Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
| vg1020568417 | C -> T | LOC_Os10g38510-LOC_Os10g38520 | intergenic_region ; MODIFIER | silent_mutation | Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
| vg1020568417 | C -> DEL | N | N | silent_mutation | Average:12.247; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020568417 | NA | 1.66E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 1.50E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 5.40E-17 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 1.19E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | 4.29E-08 | NA | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | 1.19E-06 | NA | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 2.13E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 4.71E-13 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020568417 | NA | 7.86E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |