\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020563532:

Variant ID: vg1020563532 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20563532
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, G: 0.22, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATGATCTTGGCATTGACTTCTTCTTCAGACATGTGGATATAAAATTCGTGGTCCCACCAGGCGTGCCAATCTGTGTTGACGAGAAAATCGAACACAC[C/G]
GGCCTGGGAGATCTGCTTAGCTCCTGTGCAGATCCAAATCTTGATTAGATGCGAGCGTGCCAGTCAGTTTGATCCTGCAATTAACAAGATATGCAAATAG

Reverse complement sequence

CTATTTGCATATCTTGTTAATTGCAGGATCAAACTGACTGGCACGCTCGCATCTAATCAAGATTTGGATCTGCACAGGAGCTAAGCAGATCTCCCAGGCC[G/C]
GTGTGTTCGATTTTCTCGTCAACACAGATTGGCACGCCTGGTGGGACCACGAATTTTATATCCACATGTCTGAAGAAGAAGTCAATGCCAAGATCATTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.80% 0.04% 0.00% NA
All Indica  2759 97.80% 2.20% 0.07% 0.00% NA
All Japonica  1512 7.70% 92.30% 0.00% 0.00% NA
Aus  269 26.40% 73.60% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.60% 0.25% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.70% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020563532 C -> G LOC_Os10g38489.1 downstream_gene_variant ; 2742.0bp to feature; MODIFIER silent_mutation Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg1020563532 C -> G LOC_Os10g38510.1 downstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg1020563532 C -> G LOC_Os10g38489-LOC_Os10g38510 intergenic_region ; MODIFIER silent_mutation Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020563532 2.50E-10 7.68E-54 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 2.33E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 5.70E-12 1.07E-60 mr1558 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 4.21E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 1.76E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 6.04E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 1.09E-12 5.80E-62 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 1.85E-06 1.51E-09 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 6.25E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 1.09E-20 1.41E-84 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 9.13E-10 2.52E-15 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020563532 NA 7.96E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251