\
| Variant ID: vg1020563532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20563532 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, G: 0.22, others allele: 0.00, population size: 204. )
TGAATGATCTTGGCATTGACTTCTTCTTCAGACATGTGGATATAAAATTCGTGGTCCCACCAGGCGTGCCAATCTGTGTTGACGAGAAAATCGAACACAC[C/G]
GGCCTGGGAGATCTGCTTAGCTCCTGTGCAGATCCAAATCTTGATTAGATGCGAGCGTGCCAGTCAGTTTGATCCTGCAATTAACAAGATATGCAAATAG
CTATTTGCATATCTTGTTAATTGCAGGATCAAACTGACTGGCACGCTCGCATCTAATCAAGATTTGGATCTGCACAGGAGCTAAGCAGATCTCCCAGGCC[G/C]
GTGTGTTCGATTTTCTCGTCAACACAGATTGGCACGCCTGGTGGGACCACGAATTTTATATCCACATGTCTGAAGAAGAAGTCAATGCCAAGATCATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 26.40% | 73.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.30% | 81.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020563532 | C -> G | LOC_Os10g38489.1 | downstream_gene_variant ; 2742.0bp to feature; MODIFIER | silent_mutation | Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg1020563532 | C -> G | LOC_Os10g38510.1 | downstream_gene_variant ; 2143.0bp to feature; MODIFIER | silent_mutation | Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg1020563532 | C -> G | LOC_Os10g38489-LOC_Os10g38510 | intergenic_region ; MODIFIER | silent_mutation | Average:30.904; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020563532 | 2.50E-10 | 7.68E-54 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 2.33E-06 | mr1509 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | 5.70E-12 | 1.07E-60 | mr1558 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 4.21E-07 | mr1558 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 1.76E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 6.04E-23 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | 1.09E-12 | 5.80E-62 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | 1.85E-06 | 1.51E-09 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 6.25E-14 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | 1.09E-20 | 1.41E-84 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | 9.13E-10 | 2.52E-15 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020563532 | NA | 7.96E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |