\
| Variant ID: vg1020537939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20537939 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAATCAACAAAGCCGAAAACAGCATACCTTAAGGTTCCACTGAAAAAGAACATTCCAAACCATACCCAAAACCCGAAAACCACTCCAGCCATTACACAG[A/T]
AGGATAGATACTGGTCCTCGCATTTTCTACAAAATCTCTCATCCGATGCAAGTGAAGAACTTGTGCATGAAATGTTCAATGGAAAGCCACATAGACCATA
TATGGTCTATGTGGCTTTCCATTGAACATTTCATGCACAAGTTCTTCACTTGCATCGGATGAGAGATTTTGTAGAAAATGCGAGGACCAGTATCTATCCT[T/A]
CTGTGTAATGGCTGGAGTGGTTTTCGGGTTTTGGGTATGGTTTGGAATGTTCTTTTTCAGTGGAACCTTAAGGTATGCTGTTTTCGGCTTTGTTGATTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.50% | 18.00% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 0.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 52.60% | 46.10% | 1.26% | 0.00% | NA |
| Aus | 269 | 57.60% | 42.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 27.50% | 70.30% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 9.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020537939 | A -> T | LOC_Os10g38450.1 | 3_prime_UTR_variant ; 242.0bp to feature; MODIFIER | silent_mutation | Average:47.316; most accessible tissue: Callus, score: 82.798 | N | N | N | N |
| vg1020537939 | A -> T | LOC_Os10g38440.1 | upstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:47.316; most accessible tissue: Callus, score: 82.798 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020537939 | 1.03E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 5.94E-07 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | 4.17E-07 | 4.15E-07 | mr1703 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.17E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 6.60E-06 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 3.05E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.59E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.71E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.84E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 4.46E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.33E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020537939 | NA | 1.21E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |