\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020531779:

Variant ID: vg1020531779 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20531779
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGTGCGAGAATTTCGAGGATCAAGCCCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCATCTTGCACCTATAACTTAAATCTAAGTATTTCTTTTCC[G/A]
CAAATATTGCATGAATAGGATTAACACGAGTACTTCGGCCACGGCTTGCGAGATAGCCTACTGGCCCCAATCCTAATTGCTGCAATTACCCTCCTTGAAT

Reverse complement sequence

ATTCAAGGAGGGTAATTGCAGCAATTAGGATTGGGGCCAGTAGGCTATCTCGCAAGCCGTGGCCGAAGTACTCGTGTTAATCCTATTCATGCAATATTTG[C/T]
GGAAAAGAAATACTTAGATTTAAGTTATAGGTGCAAGATGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGGGCTTGATCCTCGAAATTCTCGCACTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.80% 9.50% 0.59% 64.09% NA
All Indica  2759 4.10% 0.20% 0.94% 94.74% NA
All Japonica  1512 62.50% 28.90% 0.07% 8.53% NA
Aus  269 44.20% 0.00% 0.37% 55.39% NA
Indica I  595 8.70% 0.00% 2.02% 89.24% NA
Indica II  465 0.90% 0.90% 0.22% 98.06% NA
Indica III  913 3.10% 0.00% 0.66% 96.28% NA
Indica Intermediate  786 3.80% 0.10% 0.89% 95.17% NA
Temperate Japonica  767 86.80% 11.10% 0.00% 2.09% NA
Tropical Japonica  504 21.60% 58.90% 0.20% 19.25% NA
Japonica Intermediate  241 70.50% 22.80% 0.00% 6.64% NA
VI/Aromatic  96 11.50% 0.00% 0.00% 88.54% NA
Intermediate  90 35.60% 6.70% 0.00% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020531779 G -> A LOC_Os10g38420.1 downstream_gene_variant ; 2244.0bp to feature; MODIFIER silent_mutation Average:6.361; most accessible tissue: Callus, score: 14.153 N N N N
vg1020531779 G -> A LOC_Os10g38440.1 downstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:6.361; most accessible tissue: Callus, score: 14.153 N N N N
vg1020531779 G -> A LOC_Os10g38420-LOC_Os10g38440 intergenic_region ; MODIFIER silent_mutation Average:6.361; most accessible tissue: Callus, score: 14.153 N N N N
vg1020531779 G -> DEL N N silent_mutation Average:6.361; most accessible tissue: Callus, score: 14.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020531779 NA 7.48E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 2.04E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 2.21E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 8.24E-06 8.23E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 1.06E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 1.66E-06 1.89E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 4.77E-06 4.77E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 5.51E-06 3.02E-07 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.93E-06 3.93E-06 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.85E-06 2.84E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 2.86E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 9.16E-06 9.16E-06 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 7.90E-06 7.88E-06 mr1311_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.86E-07 8.73E-07 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 7.03E-06 7.03E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 9.17E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 2.97E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 8.33E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 4.86E-06 4.86E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.21E-07 1.20E-08 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 9.63E-07 9.62E-07 mr1374_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 6.95E-07 6.35E-09 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 8.39E-06 5.92E-07 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 1.37E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 4.07E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 5.61E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 7.25E-06 1.03E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 4.92E-07 NA mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.12E-06 2.12E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.20E-06 9.69E-08 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.74E-07 3.74E-07 mr1674_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.47E-06 2.47E-06 mr1674_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.48E-06 3.89E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 5.39E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 5.61E-06 6.51E-08 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 1.41E-06 1.42E-06 mr1688_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.51E-06 2.51E-06 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 6.54E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 7.29E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.27E-07 3.26E-07 mr1766_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 5.87E-06 3.63E-08 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 6.99E-06 2.51E-07 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 3.11E-06 3.49E-07 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 5.20E-07 5.20E-07 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 1.04E-06 9.39E-08 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 9.90E-07 8.89E-08 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 1.91E-06 2.60E-07 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 8.49E-08 8.49E-08 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 5.90E-07 5.90E-07 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 2.82E-07 2.82E-07 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020531779 NA 6.46E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251