\
| Variant ID: vg1020531763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20531763 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGGAGCCCTTAGACCCGCAGTGCGAGAATTTCGAGGATCAAGCCCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCATCTTGCACCTATAACTTAAATC[T/G]
AAGTATTTCTTTTCCGCAAATATTGCATGAATAGGATTAACACGAGTACTTCGGCCACGGCTTGCGAGATAGCCTACTGGCCCCAATCCTAATTGCTGCA
TGCAGCAATTAGGATTGGGGCCAGTAGGCTATCTCGCAAGCCGTGGCCGAAGTACTCGTGTTAATCCTATTCATGCAATATTTGCGGAAAAGAAATACTT[A/C]
GATTTAAGTTATAGGTGCAAGATGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGGGCTTGATCCTCGAAATTCTCGCACTGCGGGTCTAAGGGCTCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.70% | 9.50% | 0.15% | 65.68% | NA |
| All Indica | 2759 | 2.20% | 0.20% | 0.22% | 97.39% | NA |
| All Japonica | 1512 | 62.60% | 28.80% | 0.07% | 8.53% | NA |
| Aus | 269 | 43.90% | 0.00% | 0.00% | 56.13% | NA |
| Indica I | 595 | 3.50% | 0.00% | 0.17% | 96.30% | NA |
| Indica II | 465 | 0.40% | 0.90% | 0.00% | 98.71% | NA |
| Indica III | 913 | 1.30% | 0.00% | 0.33% | 98.36% | NA |
| Indica Intermediate | 786 | 3.30% | 0.10% | 0.25% | 96.31% | NA |
| Temperate Japonica | 767 | 86.80% | 11.10% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 21.80% | 58.70% | 0.20% | 19.25% | NA |
| Japonica Intermediate | 241 | 70.50% | 22.80% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 0.00% | 88.54% | NA |
| Intermediate | 90 | 35.60% | 6.70% | 0.00% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020531763 | T -> G | LOC_Os10g38420.1 | downstream_gene_variant ; 2228.0bp to feature; MODIFIER | silent_mutation | Average:6.361; most accessible tissue: Callus, score: 14.153 | N | N | N | N |
| vg1020531763 | T -> G | LOC_Os10g38440.1 | downstream_gene_variant ; 614.0bp to feature; MODIFIER | silent_mutation | Average:6.361; most accessible tissue: Callus, score: 14.153 | N | N | N | N |
| vg1020531763 | T -> G | LOC_Os10g38420-LOC_Os10g38440 | intergenic_region ; MODIFIER | silent_mutation | Average:6.361; most accessible tissue: Callus, score: 14.153 | N | N | N | N |
| vg1020531763 | T -> DEL | N | N | silent_mutation | Average:6.361; most accessible tissue: Callus, score: 14.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020531763 | 7.84E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 8.72E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.99E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 2.64E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 2.65E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.84E-06 | NA | mr1159_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 9.57E-06 | 9.57E-06 | mr1159_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 8.79E-06 | 2.05E-08 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 6.60E-06 | mr1267_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 7.09E-07 | 4.49E-09 | mr1278_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.34E-06 | 4.34E-06 | mr1278_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 8.75E-07 | 4.17E-08 | mr1284_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 3.67E-06 | 3.67E-06 | mr1284_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 6.66E-07 | 6.65E-07 | mr1286_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 4.86E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 9.31E-06 | 9.31E-06 | mr1293_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.96E-06 | 2.95E-06 | mr1311_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 3.22E-07 | 8.55E-07 | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 6.16E-06 | 6.16E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 2.99E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 4.85E-06 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.01E-06 | 3.43E-10 | mr1369_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 2.87E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.07E-06 | 4.06E-06 | mr1373_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 8.18E-08 | 3.45E-09 | mr1374_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 9.42E-07 | 9.41E-07 | mr1374_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.40E-07 | 1.06E-09 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 7.99E-06 | 5.25E-07 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.21E-06 | 1.53E-10 | mr1453_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 1.28E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 3.89E-06 | 7.61E-09 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 9.63E-07 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.58E-06 | 2.81E-08 | mr1652_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.12E-07 | 8.12E-06 | mr1663_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.25E-06 | 2.25E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.80E-07 | 1.77E-08 | mr1665_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.28E-07 | 1.28E-07 | mr1674_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.24E-06 | 2.24E-06 | mr1674_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.02E-06 | 4.65E-11 | mr1683_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 5.08E-06 | mr1683_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.22E-06 | 1.85E-08 | mr1687_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.90E-07 | 4.91E-07 | mr1688_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.70E-06 | 2.70E-06 | mr1688_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 6.77E-06 | 3.87E-06 | mr1738_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 6.61E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 1.52E-06 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.27E-07 | 2.27E-07 | mr1766_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.24E-06 | 5.17E-09 | mr1812_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 7.10E-06 | 2.37E-07 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 7.49E-06 | mr1816_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.12E-06 | 1.18E-07 | mr1832_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.88E-07 | 4.88E-07 | mr1832_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.38E-07 | 2.18E-08 | mr1833_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 9.79E-07 | 8.21E-08 | mr1833_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 4.84E-07 | 6.20E-08 | mr1843_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 9.83E-08 | 9.82E-08 | mr1843_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 1.45E-07 | 1.45E-07 | mr1847_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | 2.63E-07 | 2.63E-07 | mr1847_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 8.51E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020531763 | NA | 3.82E-06 | mr1984_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |