\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020501400:

Variant ID: vg1020501400 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20501400
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, T: 0.33, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGAGCCGCGCCTTTTTCTCTCGGGCCGCGCCCTAGCCGCCCGAGGGAAGTCTATTTCCCCTCCCTCTTTCTTTTCTTTTTCCAAAAGGGTTTAATTA[T/A]
ATCCTTTTCCTTTAGAACAAAAATCCAATAATCTTAGAAATTCAATATCTTCTCAACCGTATGTCCGTTTGACTCCGTTCAACTTCCAAAAAATCCTCAA

Reverse complement sequence

TTGAGGATTTTTTGGAAGTTGAACGGAGTCAAACGGACATACGGTTGAGAAGATATTGAATTTCTAAGATTATTGGATTTTTGTTCTAAAGGAAAAGGAT[A/T]
TAATTAAACCCTTTTGGAAAAAGAAAAGAAAGAGGGAGGGGAAATAGACTTCCCTCGGGCGGCTAGGGCGCGGCCCGAGAGAAAAAGGCGCGGCTCGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.60% 9.60% 1.12% 62.65% NA
All Indica  2759 5.50% 0.20% 1.12% 93.15% NA
All Japonica  1512 62.60% 29.00% 0.00% 8.33% NA
Aus  269 44.60% 0.70% 7.06% 47.58% NA
Indica I  595 11.90% 0.20% 0.50% 87.39% NA
Indica II  465 3.70% 0.90% 0.43% 95.05% NA
Indica III  913 1.60% 0.00% 1.20% 97.15% NA
Indica Intermediate  786 6.20% 0.10% 1.91% 91.73% NA
Temperate Japonica  767 86.60% 11.20% 0.00% 2.22% NA
Tropical Japonica  504 22.20% 58.90% 0.00% 18.85% NA
Japonica Intermediate  241 71.00% 23.20% 0.00% 5.81% NA
VI/Aromatic  96 9.40% 0.00% 0.00% 90.62% NA
Intermediate  90 33.30% 7.80% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020501400 T -> A LOC_Os10g38370.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:7.012; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1020501400 T -> A LOC_Os10g38360.1 downstream_gene_variant ; 2303.0bp to feature; MODIFIER silent_mutation Average:7.012; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1020501400 T -> A LOC_Os10g38360-LOC_Os10g38370 intergenic_region ; MODIFIER silent_mutation Average:7.012; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1020501400 T -> DEL N N silent_mutation Average:7.012; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020501400 NA 6.76E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 5.77E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 8.68E-07 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 5.58E-06 5.56E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 6.94E-06 NA mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.56E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 3.25E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 3.98E-06 1.30E-07 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 1.21E-07 6.80E-10 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 1.15E-06 1.15E-06 mr1427_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.28E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 4.74E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.15E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 9.52E-07 9.51E-07 mr1674_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.18E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 2.01E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 1.25E-06 1.25E-06 mr1688_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 6.25E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.06E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.45E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 6.64E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 3.93E-06 3.08E-07 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 1.04E-06 1.04E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 7.33E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020501400 NA 1.24E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251