Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020493947:

Variant ID: vg1020493947 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20493947
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATGGTGTTCAAGGGAAAGACGGAGGAGGAGAAGGTGGAGGGGAGGAAGCAGACGTTCGCGGTGGCGGAGACGCTGGAGGGAGCCCTGAGGGAGTGCT[C/A]
CAAGGGGAAGCCCTTCTTTGGCGGCGACGCCGTCGGGTACGTCGACGTCGCGCTCGGTGGCTTCGTCCCGTGGGTGCATGCGATGGAGGAGCTGTTCGGG

Reverse complement sequence

CCCGAACAGCTCCTCCATCGCATGCACCCACGGGACGAAGCCACCGAGCGCGACGTCGACGTACCCGACGGCGTCGCCGCCAAAGAAGGGCTTCCCCTTG[G/T]
AGCACTCCCTCAGGGCTCCCTCCAGCGTCTCCGCCACCGCGAACGTCTGCTTCCTCCCCTCCACCTTCTCCTCCTCCGTCTTTCCCTTGAACACCATCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.40% 0.25% 0.00% NA
All Indica  2759 96.00% 3.60% 0.40% 0.00% NA
All Japonica  1512 7.80% 92.10% 0.07% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 92.60% 6.40% 1.01% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 94.40% 5.20% 0.38% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.50% 0.20% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020493947 C -> A LOC_Os10g38350.1 missense_variant ; p.Ser148Tyr; MODERATE nonsynonymous_codon ; S148Y Average:63.607; most accessible tissue: Zhenshan97 root, score: 89.905 benign 0.051 DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020493947 C A 0.0 0.0 -0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020493947 2.47E-09 1.32E-54 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 6.55E-07 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 1.51E-10 2.49E-63 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 5.09E-08 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 6.62E-25 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 4.54E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 2.95E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 6.74E-15 2.67E-66 mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 1.24E-06 6.71E-10 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 6.94E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 2.56E-20 5.88E-92 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 2.59E-10 5.54E-17 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 8.08E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020493947 NA 3.68E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251