\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020436231:

Variant ID: vg1020436231 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20436231
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGGCCACTATTTCACACCCTCAAGCGATTGCTATGTCCGCGCCGCTGGCCACCTTCTCCATCATTATTAGGTGAGGCCGGAGATGAACGAGAGGCAGC[A/C]
CTGACGCTGCTCCTCGTCGTCCAGGCAATGGCCGCGGTCTCCAGACAGGTTTCTCCTGCAGCGTGCGCTATACCCCGATGGCACACGCGCGCGCTTGTGT

Reverse complement sequence

ACACAAGCGCGCGCGTGTGCCATCGGGGTATAGCGCACGCTGCAGGAGAAACCTGTCTGGAGACCGCGGCCATTGCCTGGACGACGAGGAGCAGCGTCAG[T/G]
GCTGCCTCTCGTTCATCTCCGGCCTCACCTAATAATGATGGAGAAGGTGGCCAGCGGCGCGGACATAGCAATCGCTTGAGGGTGTGAAATAGTGGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.40% 0.21% 0.00% NA
All Indica  2759 96.60% 3.00% 0.33% 0.00% NA
All Japonica  1512 8.50% 91.50% 0.07% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 93.30% 6.40% 0.34% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 95.70% 3.70% 0.64% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.60% 0.20% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020436231 A -> C LOC_Os10g38140.1 upstream_gene_variant ; 2966.0bp to feature; MODIFIER silent_mutation Average:77.728; most accessible tissue: Callus, score: 99.517 N N N N
vg1020436231 A -> C LOC_Os10g38150.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:77.728; most accessible tissue: Callus, score: 99.517 N N N N
vg1020436231 A -> C LOC_Os10g38160.1 upstream_gene_variant ; 1689.0bp to feature; MODIFIER silent_mutation Average:77.728; most accessible tissue: Callus, score: 99.517 N N N N
vg1020436231 A -> C LOC_Os10g38130.1 downstream_gene_variant ; 4509.0bp to feature; MODIFIER silent_mutation Average:77.728; most accessible tissue: Callus, score: 99.517 N N N N
vg1020436231 A -> C LOC_Os10g38150-LOC_Os10g38160 intergenic_region ; MODIFIER silent_mutation Average:77.728; most accessible tissue: Callus, score: 99.517 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020436231 A C 0.09 -0.03 0.0 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020436231 7.70E-07 8.08E-49 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 8.65E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 3.56E-09 1.33E-61 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 2.96E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.74E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.97E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.93E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.73E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 1.87E-09 1.51E-56 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 5.55E-08 2.19E-11 mr1509_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 5.19E-06 5.19E-06 mr1514_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 2.82E-15 6.16E-87 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 4.48E-09 1.71E-15 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.11E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 2.66E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 3.93E-20 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 6.50E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020436231 NA 1.88E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251