Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020424844:

Variant ID: vg1020424844 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20424844
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATGCGTGCCAAACCGACGGACCTACCCAGTAGTCGCACACTCGCACTAATTCCTGTAGGTTGTACTACCCTGATTTCCTTGTCACTCCACCTTTGTGG[A/T]
ACCTCGGTATCCGTGCTCTCTGAGCGCGTATACCAAATATCCCACATACACCATTGTTTGTCGAAAACTTGGGAAATGGGTTTGAGAAGCCTTGAAAACC

Reverse complement sequence

GGTTTTCAAGGCTTCTCAAACCCATTTCCCAAGTTTTCGACAAACAATGGTGTATGTGGGATATTTGGTATACGCGCTCAGAGAGCACGGATACCGAGGT[T/A]
CCACAAAGGTGGAGTGACAAGGAAATCAGGGTAGTACAACCTACAGGAATTAGTGCGAGTGTGCGACTACTGGGTAGGTCCGTCGGTTTGGCACGCATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	33.50%	5.71%	2.77%	NA
All Indica	2759	94.70%	1.70%	2.61%	0.91%	NA
All Japonica	1512	2.10%	91.40%	1.12%	5.42%	NA
Aus	269	17.10%	42.80%	33.46%	6.69%	NA
Indica I	595	93.30%	1.80%	3.53%	1.34%	NA
Indica II	465	95.50%	1.70%	1.72%	1.08%	NA
Indica III	913	97.30%	0.70%	1.97%	0.11%	NA
Indica Intermediate	786	92.50%	2.90%	3.18%	1.40%	NA
Temperate Japonica	767	1.30%	97.80%	0.39%	0.52%	NA
Tropical Japonica	504	3.00%	80.80%	1.39%	14.88%	NA
Japonica Intermediate	241	2.50%	93.40%	2.90%	1.24%	NA
VI/Aromatic	96	8.30%	7.30%	82.29%	2.08%	NA
Intermediate	90	46.70%	35.60%	13.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020424844	A -> T	LOC_Os10g38120.1	downstream_gene_variant ; 1960.0bp to feature; MODIFIER	silent_mutation	Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864	N	N	N	N
vg1020424844	A -> T	LOC_Os10g38110-LOC_Os10g38120	intergenic_region ; MODIFIER	silent_mutation	Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864	N	N	N	N
vg1020424844	A -> DEL	N	N	silent_mutation	Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020424844	2.05E-07	5.51E-50	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	2.11E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	2.96E-10	1.58E-64	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.13E-07	mr1558	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	8.76E-12	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.25E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	2.07E-25	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	2.35E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.83E-20	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	3.16E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	6.56E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	5.39E-09	5.73E-57	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	3.73E-09	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	7.67E-15	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	1.12E-19	4.04E-93	mr1558_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	1.05E-09	1.96E-16	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.14E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	6.80E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.58E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	2.10E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	2.37E-20	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.11E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844	NA	1.21E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251