\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020424844:

Variant ID: vg1020424844 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20424844
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATGCGTGCCAAACCGACGGACCTACCCAGTAGTCGCACACTCGCACTAATTCCTGTAGGTTGTACTACCCTGATTTCCTTGTCACTCCACCTTTGTGG[A/T]
ACCTCGGTATCCGTGCTCTCTGAGCGCGTATACCAAATATCCCACATACACCATTGTTTGTCGAAAACTTGGGAAATGGGTTTGAGAAGCCTTGAAAACC

Reverse complement sequence

GGTTTTCAAGGCTTCTCAAACCCATTTCCCAAGTTTTCGACAAACAATGGTGTATGTGGGATATTTGGTATACGCGCTCAGAGAGCACGGATACCGAGGT[T/A]
CCACAAAGGTGGAGTGACAAGGAAATCAGGGTAGTACAACCTACAGGAATTAGTGCGAGTGTGCGACTACTGGGTAGGTCCGTCGGTTTGGCACGCATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 33.50% 5.71% 2.77% NA
All Indica  2759 94.70% 1.70% 2.61% 0.91% NA
All Japonica  1512 2.10% 91.40% 1.12% 5.42% NA
Aus  269 17.10% 42.80% 33.46% 6.69% NA
Indica I  595 93.30% 1.80% 3.53% 1.34% NA
Indica II  465 95.50% 1.70% 1.72% 1.08% NA
Indica III  913 97.30% 0.70% 1.97% 0.11% NA
Indica Intermediate  786 92.50% 2.90% 3.18% 1.40% NA
Temperate Japonica  767 1.30% 97.80% 0.39% 0.52% NA
Tropical Japonica  504 3.00% 80.80% 1.39% 14.88% NA
Japonica Intermediate  241 2.50% 93.40% 2.90% 1.24% NA
VI/Aromatic  96 8.30% 7.30% 82.29% 2.08% NA
Intermediate  90 46.70% 35.60% 13.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020424844 A -> T LOC_Os10g38120.1 downstream_gene_variant ; 1960.0bp to feature; MODIFIER silent_mutation Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864 N N N N
vg1020424844 A -> T LOC_Os10g38110-LOC_Os10g38120 intergenic_region ; MODIFIER silent_mutation Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864 N N N N
vg1020424844 A -> DEL N N silent_mutation Average:8.099; most accessible tissue: Minghui63 young leaf, score: 13.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020424844 2.05E-07 5.51E-50 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 2.11E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 2.96E-10 1.58E-64 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.13E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 8.76E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.25E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 2.07E-25 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 2.35E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.83E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 3.16E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 6.56E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 5.39E-09 5.73E-57 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 3.73E-09 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 7.67E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 1.12E-19 4.04E-93 mr1558_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 1.05E-09 1.96E-16 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.14E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 6.80E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.58E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 2.10E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 2.37E-20 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.11E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020424844 NA 1.21E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251