\
| Variant ID: vg1020420315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20420315 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTGGTCATGATTACCATCAAACACTTATCAAAGCTAAAAAAAACTATTCTAACAAAAAAAATTTAAAAGTAAGAGTGATCTTTTTTTTAAAAAAAGAGAG[C/A]
GAAATGATTTTAAATACATTAGAGTAAGGAAAATCAGGGGCCCGGTTCGGCTGACCACTTGCACACCCTCATGGAGGACCATGTTTGAACTTGAAGCATG
CATGCTTCAAGTTCAAACATGGTCCTCCATGAGGGTGTGCAAGTGGTCAGCCGAACCGGGCCCCTGATTTTCCTTACTCTAATGTATTTAAAATCATTTC[G/T]
CTCTCTTTTTTTAAAAAAAAGATCACTCTTACTTTTAAATTTTTTTTGTTAGAATAGTTTTTTTTAGCTTTGATAAGTGTTTGATGGTAATCATGACCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 1.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.50% | 81.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020420315 | C -> A | LOC_Os10g38110.1 | upstream_gene_variant ; 3824.0bp to feature; MODIFIER | silent_mutation | Average:47.017; most accessible tissue: Callus, score: 74.022 | N | N | N | N |
| vg1020420315 | C -> A | LOC_Os10g38110-LOC_Os10g38120 | intergenic_region ; MODIFIER | silent_mutation | Average:47.017; most accessible tissue: Callus, score: 74.022 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020420315 | 2.24E-09 | 1.49E-53 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | NA | 4.77E-07 | mr1509 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | 1.09E-11 | 1.83E-61 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | NA | 2.73E-08 | mr1558 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | NA | 2.99E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | 9.90E-16 | 2.81E-66 | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | 1.25E-07 | 5.83E-11 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | NA | 1.90E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | 7.21E-22 | 1.13E-86 | mr1558_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020420315 | 2.71E-11 | 1.80E-17 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |