\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020403500:

Variant ID: vg1020403500 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20403500
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTAGTAGTTCTATGTTTCTGAAACGGAAATAAAGTTTTTGAGTTATCAAAAATACTCCTAAGGGCCTGTTTGGCACAGTTCTAACCAAACAGTTTCA[A/G]
CTCCACTAAAACTGGGAGTGGAGCTGGGTGGAACTCTCTCACAAAATGAACTATAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCTACTCCAGACC

Reverse complement sequence

GGTCTGGAGTAGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTATAGTTCATTTTGTGAGAGAGTTCCACCCAGCTCCACTCCCAGTTTTAGTGGAG[T/C]
TGAAACTGTTTGGTTAGAACTGTGCCAAACAGGCCCTTAGGAGTATTTTTGATAACTCAAAAACTTTATTTCCGTTTCAGAAACATAGAACTACTACATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 33.10% 0.06% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 8.90% 91.00% 0.07% 0.00% NA
Aus  269 57.20% 42.40% 0.37% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 2.50% 97.40% 0.13% 0.00% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 13.50% 1.04% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020403500 A -> G LOC_Os10g38090.1 upstream_gene_variant ; 4161.0bp to feature; MODIFIER silent_mutation Average:39.883; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg1020403500 A -> G LOC_Os10g38100.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:39.883; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg1020403500 A -> G LOC_Os10g38090-LOC_Os10g38100 intergenic_region ; MODIFIER silent_mutation Average:39.883; most accessible tissue: Minghui63 root, score: 65.927 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020403500 1.99E-08 2.07E-50 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 5.39E-06 9.06E-09 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 6.19E-12 1.40E-64 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 1.54E-06 2.89E-09 mr1558 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 6.99E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 3.33E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 3.09E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 7.13E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 1.46E-18 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 3.88E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 1.25E-09 9.00E-56 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 2.33E-07 1.27E-10 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 8.92E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 5.25E-18 2.87E-89 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 4.96E-09 1.68E-15 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 7.91E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 6.74E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 7.25E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 8.99E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 7.97E-21 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 1.89E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 1.15E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020403500 NA 1.07E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251