\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020402835:

Variant ID: vg1020402835 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20402835
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAACAAATTCCCTTATATTTAGAGACGGAGGGAGTAAGATGTCTTAGCACAGTTTTCGAAACTAATTTATGATTTGTAGTTTCCTAAAGTTTGTAACAA[C/A]
AAAATTATAATCATATAAAAGTAAATTAAAATATCAATTCAATGATATTATTTTCAGCAAATAAAATTTAGTTTATACTGTACAAATTGTTAGTTAGTAG

Reverse complement sequence

CTACTAACTAACAATTTGTACAGTATAAACTAAATTTTATTTGCTGAAAATAATATCATTGAATTGATATTTTAATTTACTTTTATATGATTATAATTTT[G/T]
TTGTTACAAACTTTAGGAAACTACAAATCATAAATTAGTTTCGAAAACTGTGCTAAGACATCTTACTCCCTCCGTCTCTAAATATAAGGGAATTTGTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 33.20% 0.11% 0.00% NA
All Indica  2759 98.70% 1.20% 0.11% 0.00% NA
All Japonica  1512 8.80% 91.20% 0.00% 0.00% NA
Aus  269 56.90% 42.80% 0.37% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.80% 0.13% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020402835 C -> A LOC_Os10g38090.1 upstream_gene_variant ; 3496.0bp to feature; MODIFIER silent_mutation Average:25.618; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1020402835 C -> A LOC_Os10g38100.1 downstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:25.618; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1020402835 C -> A LOC_Os10g38090-LOC_Os10g38100 intergenic_region ; MODIFIER silent_mutation Average:25.618; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020402835 NA 9.70E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 8.05E-09 3.67E-54 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 6.42E-08 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 3.71E-10 7.34E-66 mr1558 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 2.55E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 4.54E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 8.18E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 1.23E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 1.95E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 1.93E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 1.54E-10 1.15E-61 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 2.47E-06 2.03E-09 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 5.43E-18 4.28E-93 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 7.74E-09 2.46E-14 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 4.77E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 3.24E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 1.49E-18 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 7.70E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402835 NA 2.02E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251