\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020402458:

Variant ID: vg1020402458 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20402458
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTAAGTATACGGACACACATTTGAAGTATTAAACATATACTAATAACTAAACAAATTACAAATTCCACCTGTAAACTGTGAGATGAATCTATTAAG[T/C]
CTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCATATTATCAAATCATGACGTAATTAGGCTCAAAAGATTCGTCTCGCGATTTACATGCAAAC

Reverse complement sequence

GTTTGCATGTAAATCGCGAGACGAATCTTTTGAGCCTAATTACGTCATGATTTGATAATATGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAG[A/G]
CTTAATAGATTCATCTCACAGTTTACAGGTGGAATTTGTAATTTGTTTAGTTATTAGTATATGTTTAATACTTCAAATGTGTGTCCGTATACTTAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 24.90% 0.55% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 31.20% 67.10% 1.72% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 25.20% 72.20% 2.61% 0.00% NA
Tropical Japonica  504 33.30% 66.30% 0.40% 0.00% NA
Japonica Intermediate  241 45.60% 52.70% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020402458 T -> C LOC_Os10g38090.1 upstream_gene_variant ; 3119.0bp to feature; MODIFIER silent_mutation Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1020402458 T -> C LOC_Os10g38100.1 downstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1020402458 T -> C LOC_Os10g38090-LOC_Os10g38100 intergenic_region ; MODIFIER silent_mutation Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020402458 NA 5.41E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 7.93E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 7.09E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 8.64E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 1.33E-06 1.33E-06 mr1649_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 9.87E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 3.99E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 1.60E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020402458 NA 5.37E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251