\
| Variant ID: vg1020402458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20402458 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTTAAGTATACGGACACACATTTGAAGTATTAAACATATACTAATAACTAAACAAATTACAAATTCCACCTGTAAACTGTGAGATGAATCTATTAAG[T/C]
CTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCATATTATCAAATCATGACGTAATTAGGCTCAAAAGATTCGTCTCGCGATTTACATGCAAAC
GTTTGCATGTAAATCGCGAGACGAATCTTTTGAGCCTAATTACGTCATGATTTGATAATATGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAG[A/G]
CTTAATAGATTCATCTCACAGTTTACAGGTGGAATTTGTAATTTGTTTAGTTATTAGTATATGTTTAATACTTCAAATGTGTGTCCGTATACTTAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 24.90% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 31.20% | 67.10% | 1.72% | 0.00% | NA |
| Aus | 269 | 57.20% | 42.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 25.20% | 72.20% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 33.30% | 66.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.60% | 52.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020402458 | T -> C | LOC_Os10g38090.1 | upstream_gene_variant ; 3119.0bp to feature; MODIFIER | silent_mutation | Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1020402458 | T -> C | LOC_Os10g38100.1 | downstream_gene_variant ; 4953.0bp to feature; MODIFIER | silent_mutation | Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1020402458 | T -> C | LOC_Os10g38090-LOC_Os10g38100 | intergenic_region ; MODIFIER | silent_mutation | Average:41.071; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020402458 | NA | 5.41E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 7.93E-19 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 7.09E-08 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 8.64E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | 1.33E-06 | 1.33E-06 | mr1649_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 9.87E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 3.99E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 1.60E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020402458 | NA | 5.37E-10 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |