\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020389432:

Variant ID: vg1020389432 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 20389432
Reference Allele: CAAAlternative Allele: AAA,CA,C,CCAAAA,CAAA,CCAAA
Primary Allele: AAASecondary Allele: CAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTACTACCAAACAAAAGCAGTTCTTCTGTAAGCAAAGCAGAGCAAACTGTACTCCCTGAAGCATCTAACCACCTGTTTCTTTGAATACTCCCTCCGTC[CAA/AAA,CA,C,CCAAAA,CAAA,CCAAA]
AAAAAAAAAAAGGCAAACCCTAAATTTACGTGTCTAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCGTATTTTTATTGGTATTAGATGAT

Reverse complement sequence

ATCATCTAATACCAATAAAAATACGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTAGACACGTAAATTTAGGGTTTGCCTTTTTTTTTTT[TTG/TTT,TG,G,TTTTGG,TTTG,TTTGG]
GACGGAGGGAGTATTCAAAGAAACAGGTGGTTAGATGCTTCAGGGAGTACAGTTTGCTCTGCTTTGCTTACAGAAGAACTGCTTTTGTTTGGTAGTAGGA

Allele Frequencies:

Populations Population SizeFrequency of AAA(primary allele) Frequency of CAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 14.00% 12.70% 0.28% CA: 7.45%; C: 1.61%; CCAAAA: 0.61%; CAAA: 0.42%; CCAAA: 0.23%
All Indica  2759 98.20% 0.80% 0.80% 0.00% CA: 0.14%; CCAAAA: 0.11%
All Japonica  1512 8.30% 40.70% 21.83% 0.86% CA: 22.22%; C: 4.76%; CAAA: 1.32%
Aus  269 28.30% 0.40% 60.97% 0.00% CCAAAA: 8.18%; CCAAA: 1.49%; CA: 0.74%
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 98.90% 0.60% 0.22% 0.00% CA: 0.22%
Indica III  913 99.10% 0.20% 0.33% 0.00% CA: 0.22%; CCAAAA: 0.11%
Indica Intermediate  786 96.80% 0.60% 2.16% 0.00% CCAAAA: 0.25%; CA: 0.13%
Temperate Japonica  767 2.50% 56.20% 24.25% 0.65% CA: 14.86%; C: 1.17%; CAAA: 0.39%
Tropical Japonica  504 19.00% 26.80% 13.89% 1.19% CA: 28.57%; C: 8.73%; CAAA: 1.79%
Japonica Intermediate  241 4.10% 20.70% 30.71% 0.83% CA: 32.37%; C: 7.88%; CAAA: 3.32%
VI/Aromatic  96 6.20% 9.40% 69.79% 0.00% CCAAA: 7.29%; CA: 4.17%; CCAAAA: 3.12%
Intermediate  90 54.40% 14.40% 18.89% 0.00% CA: 6.67%; C: 4.44%; CCAAAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020389432 CAA -> C LOC_Os10g38060.1 upstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> C LOC_Os10g38070.1 upstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> C LOC_Os10g38060.2 upstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> C LOC_Os10g38080.1 downstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> C LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CAAA LOC_Os10g38060.1 upstream_gene_variant ; 3350.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CAAA LOC_Os10g38070.1 upstream_gene_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CAAA LOC_Os10g38060.2 upstream_gene_variant ; 3339.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CAAA LOC_Os10g38080.1 downstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CAAA LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAAA LOC_Os10g38060.1 upstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAAA LOC_Os10g38070.1 upstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAAA LOC_Os10g38060.2 upstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAAA LOC_Os10g38080.1 downstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAAA LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAA LOC_Os10g38060.1 upstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAA LOC_Os10g38070.1 upstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAA LOC_Os10g38060.2 upstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAA LOC_Os10g38080.1 downstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CCAAA LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> DEL N N silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> AAA LOC_Os10g38060.1 upstream_gene_variant ; 3347.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> AAA LOC_Os10g38070.1 upstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> AAA LOC_Os10g38060.2 upstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> AAA LOC_Os10g38080.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> AAA LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CA LOC_Os10g38060.1 upstream_gene_variant ; 3349.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CA LOC_Os10g38070.1 upstream_gene_variant ; 570.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CA LOC_Os10g38060.2 upstream_gene_variant ; 3338.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CA LOC_Os10g38080.1 downstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N
vg1020389432 CAA -> CA LOC_Os10g38070-LOC_Os10g38080 intergenic_region ; MODIFIER silent_mutation Average:77.326; most accessible tissue: Callus, score: 99.532 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1020389432 CAA AAA -0.06 -0.05 -0.03 -0.02 -0.04 -0.05
vg1020389432 CAA C 0.0 -0.11 -0.11 -0.32 -0.16 -0.07
vg1020389432 CAA CA -0.04 -0.1 -0.11 -0.08 -0.09 -0.11
vg1020389432 CAA CAAA 0.04 0.0 0.01 0.04 -0.02 -0.13
vg1020389432 CAA CCAAA -0.08 -0.12 -0.16 -0.04 -0.07 -0.1
vg1020389432 CAA CCAAA* 0.06 -0.08 -0.11 -0.06 -0.04 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020389432 NA 6.60E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 9.77E-12 2.29E-56 mr1509 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 NA 2.74E-07 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 2.98E-09 4.02E-58 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 1.29E-11 4.70E-62 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 7.11E-06 1.34E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 NA 1.22E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 4.26E-14 4.04E-78 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020389432 6.11E-08 2.33E-12 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251