\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020380304:

Variant ID: vg1020380304 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20380304
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CAATATGCTCCGCCCAAAGAGACATTCTGTACCCATAAATCTACACATGAAATCAGCAGATTTGAATTAGAGTGTGGTTCTAGAAATATCAGTCATCCTA[A/C]
AATAGGTATATCCCTCAAACCAAGAGACAACTAGTCGAGATTCCTTCACAGTTGTACAGGGCTATTTGAAATATGACTGTACTTGATATGCAACTTTTTC

Reverse complement sequence

GAAAAAGTTGCATATCAAGTACAGTCATATTTCAAATAGCCCTGTACAACTGTGAAGGAATCTCGACTAGTTGTCTCTTGGTTTGAGGGATATACCTATT[T/G]
TAGGATGACTGATATTTCTAGAACCACACTCTAATTCAAATCTGCTGATTTCATGTGTAGATTTATGGGTACAGAATGTCTCTTTGGGCGGAGCATATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.40% 0.19% 0.00% NA
All Indica  2759 99.20% 0.80% 0.07% 0.00% NA
All Japonica  1512 17.30% 82.30% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 10.40% 88.90% 0.65% 0.00% NA
Tropical Japonica  504 28.60% 71.20% 0.20% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020380304 A -> C LOC_Os10g38040.1 downstream_gene_variant ; 4849.0bp to feature; MODIFIER silent_mutation Average:56.17; most accessible tissue: Callus, score: 85.645 N N N N
vg1020380304 A -> C LOC_Os10g38050.1 downstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:56.17; most accessible tissue: Callus, score: 85.645 N N N N
vg1020380304 A -> C LOC_Os10g38060.1 intron_variant ; MODIFIER silent_mutation Average:56.17; most accessible tissue: Callus, score: 85.645 N N N N
vg1020380304 A -> C LOC_Os10g38060.2 intron_variant ; MODIFIER silent_mutation Average:56.17; most accessible tissue: Callus, score: 85.645 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020380304 3.63E-07 NA mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 7.42E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 1.00E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 4.26E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 4.28E-08 NA mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 3.20E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 1.08E-13 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 3.78E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 1.66E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304 NA 5.88E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251