\
| Variant ID: vg1020380304 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20380304 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )
CAATATGCTCCGCCCAAAGAGACATTCTGTACCCATAAATCTACACATGAAATCAGCAGATTTGAATTAGAGTGTGGTTCTAGAAATATCAGTCATCCTA[A/C]
AATAGGTATATCCCTCAAACCAAGAGACAACTAGTCGAGATTCCTTCACAGTTGTACAGGGCTATTTGAAATATGACTGTACTTGATATGCAACTTTTTC
GAAAAAGTTGCATATCAAGTACAGTCATATTTCAAATAGCCCTGTACAACTGTGAAGGAATCTCGACTAGTTGTCTCTTGGTTTGAGGGATATACCTATT[T/G]
TAGGATGACTGATATTTCTAGAACCACACTCTAATTCAAATCTGCTGATTTCATGTGTAGATTTATGGGTACAGAATGTCTCTTTGGGCGGAGCATATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 27.40% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 17.30% | 82.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 10.40% | 88.90% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.80% | 84.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020380304 | A -> C | LOC_Os10g38040.1 | downstream_gene_variant ; 4849.0bp to feature; MODIFIER | silent_mutation | Average:56.17; most accessible tissue: Callus, score: 85.645 | N | N | N | N |
| vg1020380304 | A -> C | LOC_Os10g38050.1 | downstream_gene_variant ; 69.0bp to feature; MODIFIER | silent_mutation | Average:56.17; most accessible tissue: Callus, score: 85.645 | N | N | N | N |
| vg1020380304 | A -> C | LOC_Os10g38060.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.17; most accessible tissue: Callus, score: 85.645 | N | N | N | N |
| vg1020380304 | A -> C | LOC_Os10g38060.2 | intron_variant ; MODIFIER | silent_mutation | Average:56.17; most accessible tissue: Callus, score: 85.645 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020380304 | 3.63E-07 | NA | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 7.42E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 1.00E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 4.26E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | 4.28E-08 | NA | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 3.20E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 1.08E-13 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 3.78E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 1.66E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020380304 | NA | 5.88E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |