\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020360604:

Variant ID: vg1020360604 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20360604
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTCCTACATGTTGCTTTGATTCATAGAAAAGAAACAAAAGTTCTATAGGATTGTATTCATATGCTTCACATTTCATAGAAAAAATAGCGTGAACTTT[C/T]
CTTTGTTTTTCTCATAGCACGATCAAATAGCTCCTATTATCTTTCCTGTTGATTCCTGTAGGATTTGAGAAACATACTATTTCACGTCTTGTATTTTTCC

Reverse complement sequence

GGAAAAATACAAGACGTGAAATAGTATGTTTCTCAAATCCTACAGGAATCAACAGGAAAGATAATAGGAGCTATTTGATCGTGCTATGAGAAAAACAAAG[G/A]
AAAGTTCACGCTATTTTTTCTATGAAATGTGAAGCATATGAATACAATCCTATAGAACTTTTGTTTCTTTTCTATGAATCAAAGCAACATGTAGGAAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.70% 0.02% 0.00% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020360604 C -> T LOC_Os10g38020.1 upstream_gene_variant ; 343.0bp to feature; MODIFIER silent_mutation Average:49.933; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1020360604 C -> T LOC_Os10g38000.1 downstream_gene_variant ; 4947.0bp to feature; MODIFIER silent_mutation Average:49.933; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1020360604 C -> T LOC_Os10g38030.1 downstream_gene_variant ; 4718.0bp to feature; MODIFIER silent_mutation Average:49.933; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1020360604 C -> T LOC_Os10g38000-LOC_Os10g38020 intergenic_region ; MODIFIER silent_mutation Average:49.933; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020360604 6.56E-07 NA mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020360604 NA 2.23E-42 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020360604 NA 1.55E-43 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251