\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020221107:

Variant ID: vg1020221107 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20221107
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTGAATCCCCTTGCAACGTTTGCATCATTGGTGTGGCTTGCTGAGTACGGTGGTTGTACTCAGTCTTGCTATTATTCCCCCTTTTCAGAAGTGTAGT[A/G]
CTTCTGAGCTGAAGACGGAGTTAGAGGACCAAGGCTCAGACCCCAGCTGAGTTTTGCTTGTGGAGTGGAGCTGAAGCCCCGCTAGGATCGCCTTTTTCCA

Reverse complement sequence

TGGAAAAAGGCGATCCTAGCGGGGCTTCAGCTCCACTCCACAAGCAAAACTCAGCTGGGGTCTGAGCCTTGGTCCTCTAACTCCGTCTTCAGCTCAGAAG[T/C]
ACTACACTTCTGAAAAGGGGGAATAATAGCAAGACTGAGTACAACCACCGTACTCAGCAAGCCACACCAATGATGCAAACGTTGCAAGGGGATTCAAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 29.40% 0.00% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 12.30% 87.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 29.80% 70.20% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020221107 A -> G LOC_Os10g37780.1 upstream_gene_variant ; 1957.0bp to feature; MODIFIER silent_mutation Average:42.602; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg1020221107 A -> G LOC_Os10g37800.1 downstream_gene_variant ; 4193.0bp to feature; MODIFIER silent_mutation Average:42.602; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N
vg1020221107 A -> G LOC_Os10g37780-LOC_Os10g37800 intergenic_region ; MODIFIER silent_mutation Average:42.602; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020221107 NA 4.59E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.99E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.31E-40 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 4.12E-07 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.19E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.47E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 9.51E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.58E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.16E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 5.15E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.31E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.17E-32 mr1368_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 3.38E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.40E-16 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.19E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 3.39E-09 3.61E-61 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 2.49E-06 2.11E-13 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 7.14E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 5.56E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.75E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 7.74E-06 2.92E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.52E-28 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 7.50E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 2.83E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 4.42E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 1.31E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020221107 NA 9.21E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251