\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020215571:

Variant ID: vg1020215571 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20215571
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACAGACCGGTCAGATTGCGGGTTAGGTGGCGACAGGCGGTCTGACGCACGCCTCGCCCCATCCCGTCAGGACGAGAGCCTCCAAGCACTCGTCCCTAGC[T/C]
GGAGCCGGCGTGTTAGCTCCTGGAGATGGCACGTTGGTTCCGGTATATGCCAGGCTTCATCCTAACCATTACAAGCAAGATATTGTATGAAGAGGGGCGA

Reverse complement sequence

TCGCCCCTCTTCATACAATATCTTGCTTGTAATGGTTAGGATGAAGCCTGGCATATACCGGAACCAACGTGCCATCTCCAGGAGCTAACACGCCGGCTCC[A/G]
GCTAGGGACGAGTGCTTGGAGGCTCTCGTCCTGACGGGATGGGGCGAGGCGTGCGTCAGACCGCCTGTCGCCACCTAACCCGCAATCTGACCGGTCTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.80% 0.20% 1.50% 67.48% NA
All Indica  2759 2.00% 0.30% 2.21% 95.51% NA
All Japonica  1512 89.70% 0.00% 0.20% 10.05% NA
Aus  269 2.20% 0.40% 0.74% 96.65% NA
Indica I  595 2.90% 0.70% 1.68% 94.79% NA
Indica II  465 1.50% 0.20% 1.72% 96.56% NA
Indica III  913 1.40% 0.00% 2.08% 96.50% NA
Indica Intermediate  786 2.40% 0.30% 3.05% 94.27% NA
Temperate Japonica  767 97.50% 0.00% 0.13% 2.35% NA
Tropical Japonica  504 76.40% 0.00% 0.40% 23.21% NA
Japonica Intermediate  241 92.90% 0.00% 0.00% 7.05% NA
VI/Aromatic  96 5.20% 0.00% 1.04% 93.75% NA
Intermediate  90 36.70% 1.10% 4.44% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020215571 T -> C LOC_Os10g37770.1 upstream_gene_variant ; 1284.0bp to feature; MODIFIER silent_mutation Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1020215571 T -> C LOC_Os10g37780.1 downstream_gene_variant ; 3019.0bp to feature; MODIFIER silent_mutation Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1020215571 T -> C LOC_Os10g37770-LOC_Os10g37780 intergenic_region ; MODIFIER silent_mutation Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1020215571 T -> DEL N N silent_mutation Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020215571 NA 1.13E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 1.14E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 2.85E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 2.73E-06 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 3.01E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 4.67E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 1.14E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 1.20E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 7.34E-07 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 2.47E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 2.27E-06 2.38E-13 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 4.52E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 5.24E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 NA 5.23E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020215571 2.50E-06 1.74E-13 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251