\
| Variant ID: vg1020215571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 20215571 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACAGACCGGTCAGATTGCGGGTTAGGTGGCGACAGGCGGTCTGACGCACGCCTCGCCCCATCCCGTCAGGACGAGAGCCTCCAAGCACTCGTCCCTAGC[T/C]
GGAGCCGGCGTGTTAGCTCCTGGAGATGGCACGTTGGTTCCGGTATATGCCAGGCTTCATCCTAACCATTACAAGCAAGATATTGTATGAAGAGGGGCGA
TCGCCCCTCTTCATACAATATCTTGCTTGTAATGGTTAGGATGAAGCCTGGCATATACCGGAACCAACGTGCCATCTCCAGGAGCTAACACGCCGGCTCC[A/G]
GCTAGGGACGAGTGCTTGGAGGCTCTCGTCCTGACGGGATGGGGCGAGGCGTGCGTCAGACCGCCTGTCGCCACCTAACCCGCAATCTGACCGGTCTGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 0.20% | 1.50% | 67.48% | NA |
| All Indica | 2759 | 2.00% | 0.30% | 2.21% | 95.51% | NA |
| All Japonica | 1512 | 89.70% | 0.00% | 0.20% | 10.05% | NA |
| Aus | 269 | 2.20% | 0.40% | 0.74% | 96.65% | NA |
| Indica I | 595 | 2.90% | 0.70% | 1.68% | 94.79% | NA |
| Indica II | 465 | 1.50% | 0.20% | 1.72% | 96.56% | NA |
| Indica III | 913 | 1.40% | 0.00% | 2.08% | 96.50% | NA |
| Indica Intermediate | 786 | 2.40% | 0.30% | 3.05% | 94.27% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 0.13% | 2.35% | NA |
| Tropical Japonica | 504 | 76.40% | 0.00% | 0.40% | 23.21% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.00% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 5.20% | 0.00% | 1.04% | 93.75% | NA |
| Intermediate | 90 | 36.70% | 1.10% | 4.44% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1020215571 | T -> C | LOC_Os10g37770.1 | upstream_gene_variant ; 1284.0bp to feature; MODIFIER | silent_mutation | Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg1020215571 | T -> C | LOC_Os10g37780.1 | downstream_gene_variant ; 3019.0bp to feature; MODIFIER | silent_mutation | Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg1020215571 | T -> C | LOC_Os10g37770-LOC_Os10g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg1020215571 | T -> DEL | N | N | silent_mutation | Average:13.077; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1020215571 | NA | 1.13E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 1.14E-18 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 2.85E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 2.73E-06 | mr1558 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 3.01E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 4.67E-17 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 1.14E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 1.20E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 7.34E-07 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 2.47E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | 2.27E-06 | 2.38E-13 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 4.52E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 5.24E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | NA | 5.23E-08 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1020215571 | 2.50E-06 | 1.74E-13 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |