\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020123751:

Variant ID: vg1020123751 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20123751
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTTACGTGAGAAGTTCTAACATAATACCTACATGAATAAAGTCTACCATACAGTTGGGTTGAAAGAAATCAAATAACTGATAGCATGGGCGTTGCAC[G/A]
CCTTCAAACAACACCTCGTATCATAATTAAATACTCCAGCGTAACATGGATGTTAACTGCAGAGGATAGCAAGGAAAAAACCTGGAACCATTACACGAAG

Reverse complement sequence

CTTCGTGTAATGGTTCCAGGTTTTTTCCTTGCTATCCTCTGCAGTTAACATCCATGTTACGCTGGAGTATTTAATTATGATACGAGGTGTTGTTTGAAGG[C/T]
GTGCAACGCCCATGCTATCAGTTATTTGATTTCTTTCAACCCAACTGTATGGTAGACTTTATTCATGTAGGTATTATGTTAGAACTTCTCACGTAAAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 39.40% 0.23% 9.65% NA
All Indica  2759 38.20% 53.20% 0.25% 8.37% NA
All Japonica  1512 79.70% 19.20% 0.00% 1.06% NA
Aus  269 1.90% 27.50% 1.12% 69.52% NA
Indica I  595 50.90% 48.70% 0.00% 0.34% NA
Indica II  465 23.90% 50.80% 0.86% 24.52% NA
Indica III  913 37.00% 61.20% 0.11% 1.64% NA
Indica Intermediate  786 38.40% 48.60% 0.25% 12.72% NA
Temperate Japonica  767 98.20% 0.70% 0.00% 1.17% NA
Tropical Japonica  504 46.60% 52.80% 0.00% 0.60% NA
Japonica Intermediate  241 90.00% 8.30% 0.00% 1.66% NA
VI/Aromatic  96 82.30% 3.10% 1.04% 13.54% NA
Intermediate  90 57.80% 32.20% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020123751 G -> A LOC_Os10g37610.1 upstream_gene_variant ; 2640.0bp to feature; MODIFIER silent_mutation Average:34.733; most accessible tissue: Callus, score: 89.303 N N N N
vg1020123751 G -> A LOC_Os10g37604.1 downstream_gene_variant ; 769.0bp to feature; MODIFIER silent_mutation Average:34.733; most accessible tissue: Callus, score: 89.303 N N N N
vg1020123751 G -> A LOC_Os10g37600-LOC_Os10g37604 intergenic_region ; MODIFIER silent_mutation Average:34.733; most accessible tissue: Callus, score: 89.303 N N N N
vg1020123751 G -> DEL N N silent_mutation Average:34.733; most accessible tissue: Callus, score: 89.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020123751 NA 5.55E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 1.35E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 1.21E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 2.84E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 1.76E-06 3.00E-08 mr1509 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 4.53E-07 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 2.47E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 3.80E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 7.48E-06 mr1905 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 4.06E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 1.46E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 6.56E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 9.44E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 3.82E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 3.54E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020123751 NA 6.41E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251