\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020120628:

Variant ID: vg1020120628 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20120628
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TATTACAACTGTTTTTCCGCTTTCAACCTCTGTTTATAAATGCCAGTATTACGCAAATGAACCTTTATAGCTATCCCTTGATAAATCCCTGCATCATACC[A/C]
CTATCCCGGTATGACTTGCTGAGTACAGTGGGTAGTACTCAGTCTTGCTCTATTTTCCCCCAATTCCAGAGTATGAGTATGTGTCAGATGGTGGTTTCTC

Reverse complement sequence

GAGAAACCACCATCTGACACATACTCATACTCTGGAATTGGGGGAAAATAGAGCAAGACTGAGTACTACCCACTGTACTCAGCAAGTCATACCGGGATAG[T/G]
GGTATGATGCAGGGATTTATCAAGGGATAGCTATAAAGGTTCATTTGCGTAATACTGGCATTTATAAACAGAGGTTGAAAGCGGAAAAACAGTTGTAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 26.20% 3.28% 0.59% NA
All Indica  2759 94.50% 0.80% 3.81% 0.91% NA
All Japonica  1512 21.00% 78.40% 0.66% 0.00% NA
Aus  269 85.90% 0.40% 12.64% 1.12% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 84.50% 0.60% 11.83% 3.01% NA
Indica III  913 99.00% 0.20% 0.55% 0.22% NA
Indica Intermediate  786 92.20% 1.00% 5.60% 1.15% NA
Temperate Japonica  767 1.40% 97.70% 0.91% 0.00% NA
Tropical Japonica  504 55.00% 44.80% 0.20% 0.00% NA
Japonica Intermediate  241 12.00% 87.10% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 65.60% 27.80% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020120628 A -> C LOC_Os10g37600.1 downstream_gene_variant ; 3824.0bp to feature; MODIFIER silent_mutation Average:53.088; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1020120628 A -> C LOC_Os10g37604.1 downstream_gene_variant ; 3892.0bp to feature; MODIFIER silent_mutation Average:53.088; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1020120628 A -> C LOC_Os10g37600-LOC_Os10g37604 intergenic_region ; MODIFIER silent_mutation Average:53.088; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1020120628 A -> DEL N N silent_mutation Average:53.088; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020120628 NA 2.49E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1020120628 NA 5.44E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 5.24E-20 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 7.03E-06 5.07E-11 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 1.66E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 2.72E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.46E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.14E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 9.36E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 1.74E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.80E-24 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 2.86E-10 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.34E-38 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.46E-25 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 4.48E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 5.23E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.03E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 5.21E-09 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 2.55E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 1.27E-06 4.82E-14 mr1361_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 8.91E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 2.62E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 1.73E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.69E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.48E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 4.09E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 2.14E-16 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.26E-42 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 3.79E-46 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 4.91E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.41E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 4.24E-41 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 7.60E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020120628 NA 6.41E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251