\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019960632:

Variant ID: vg1019960632 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 19960632
Reference Allele: TAAlternative Allele: AA,T,TAAA,TAAAA,TAA,TAAAAA
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGATTCGGAAGCAAAGTTTCCATTAGACCTTGTGGTTAGCTCTATCAATCTGTAGCAATATTAGGACACTTGGGATTGACCCCTGAAAACTTTTTTTTT[TA/AA,T,TAAA,TAAAA,TAA,TAAAAA]
AAAAAAAAACCTTTCAAAGCATCTGTGTTTCTTTTCGTTGATAGGCGCTTAGCCAGATTGTCAATACTTTGGGTCTGTTTGATACAGCTCCAACTCATAA

Reverse complement sequence

TTATGAGTTGGAGCTGTATCAAACAGACCCAAAGTATTGACAATCTGGCTAAGCGCCTATCAACGAAAAGAAACACAGATGCTTTGAAAGGTTTTTTTTT[TA/TT,A,TTTA,TTTTA,TTA,TTTTTA]
AAAAAAAAAGTTTTCAGGGGTCAATCCCAAGTGTCCTAATATTGCTACAGATTGATAGAGCTAACCACAAGGTCTAATGGAAACTTTGCTTCCGAATCAG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 41.20% 6.26% 0.23% T: 9.23%; TAAA: 0.70%; TAAAA: 0.57%; TAA: 0.40%; TAAAAA: 0.19%
All Indica  2759 43.40% 43.10% 4.35% 0.00% T: 7.50%; TAAA: 0.98%; TAAAA: 0.33%; TAAAAA: 0.29%; TAA: 0.04%
All Japonica  1512 46.20% 44.00% 5.75% 0.13% T: 1.26%; TAAAA: 1.19%; TAA: 1.12%; TAAA: 0.40%
Aus  269 4.10% 22.30% 3.72% 0.37% T: 68.77%; TAAAAA: 0.37%; TAA: 0.37%
Indica I  595 62.20% 28.10% 7.06% 0.00% TAAA: 2.52%; TAAAA: 0.17%
Indica II  465 44.90% 31.40% 1.51% 0.00% T: 21.94%; TAA: 0.22%
Indica III  913 34.30% 62.10% 1.31% 0.00% T: 1.75%; TAAAA: 0.55%
Indica Intermediate  786 38.80% 39.40% 7.51% 0.00% T: 11.32%; TAAA: 1.53%; TAAAAA: 1.02%; TAAAA: 0.38%
Temperate Japonica  767 59.70% 31.30% 6.39% 0.00% T: 1.43%; TAA: 0.52%; TAAAA: 0.39%; TAAA: 0.26%
Tropical Japonica  504 21.80% 71.80% 3.57% 0.00% TAA: 1.39%; TAAAA: 0.79%; TAAA: 0.40%; T: 0.20%
Japonica Intermediate  241 53.90% 26.10% 8.30% 0.83% TAAAA: 4.56%; T: 2.90%; TAA: 2.49%; TAAA: 0.83%
VI/Aromatic  96 10.40% 1.00% 68.75% 7.29% T: 12.50%
Intermediate  90 36.70% 33.30% 14.44% 1.11% T: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019960632 TA -> TAAAA LOC_Os10g37260.1 upstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAA LOC_Os10g37270.1 upstream_gene_variant ; 1029.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAA LOC_Os10g37280.1 upstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAA LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAA LOC_Os10g37260.1 upstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAA LOC_Os10g37270.1 upstream_gene_variant ; 1029.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAA LOC_Os10g37280.1 upstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAA LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> T LOC_Os10g37260.1 upstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> T LOC_Os10g37270.1 upstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> T LOC_Os10g37280.1 upstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> T LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> DEL N N silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAA LOC_Os10g37260.1 upstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAA LOC_Os10g37270.1 upstream_gene_variant ; 1029.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAA LOC_Os10g37280.1 upstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAA LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAAA LOC_Os10g37260.1 upstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAAA LOC_Os10g37270.1 upstream_gene_variant ; 1029.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAAA LOC_Os10g37280.1 upstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> TAAAAA LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> AA LOC_Os10g37260.1 upstream_gene_variant ; 3270.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> AA LOC_Os10g37270.1 upstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> AA LOC_Os10g37280.1 upstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1019960632 TA -> AA LOC_Os10g37260-LOC_Os10g37270 intergenic_region ; MODIFIER silent_mutation Average:59.946; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1019960632 TA AA 0.01 0.0 0.0 0.0 0.0 0.01
vg1019960632 TA T -0.03 -0.08 -0.07 -0.03 -0.05 -0.03
vg1019960632 TA TAA 0.02 0.0 -0.04 -0.06 -0.04 -0.02
vg1019960632 TA TAAA -0.04 -0.07 -0.11 -0.09 -0.1 -0.1
vg1019960632 TA TAAAA 0.05 0.08 0.06 0.03 0.07 0.07
vg1019960632 TA TAAAA* 0.08 0.11 0.09 0.06 0.11 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019960632 5.47E-06 NA mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.39E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 3.67E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.53E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 1.84E-06 NA mr1452_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 5.39E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.21E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.26E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 8.02E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.96E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019960632 NA 1.76E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251