\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019827961:

Variant ID: vg1019827961 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19827961
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCACGGTAAGCGACGACCACGACGAGATCACCGAGGACGACACCCAGAAGATGCCATACCTAAAAGCCGTCATCCTCGAGGGTCTCCGGAAGCATCCGC[C/T]
GGGACACTTCGTGCTGGCGCACAAGGCGGCGGAGGACATTGAAGTTGGCGGGTACCTCATCCCCAAGGGCGCGACGGTGAACTTCATGGTGGCCGAGATG

Reverse complement sequence

CATCTCGGCCACCATGAAGTTCACCGTCGCGCCCTTGGGGATGAGGTACCCGCCAACTTCAATGTCCTCCGCCGCCTTGTGCGCCAGCACGAAGTGTCCC[G/A]
GCGGATGCTTCCGGAGACCCTCGAGGATGACGGCTTTTAGGTATGGCATCTTCTGGGTGTCGTCCTCGGTGATCTCGTCGTGGTCGTCGCTTACCGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 31.50% 0.06% 0.00% NA
All Indica  2759 87.80% 12.10% 0.07% 0.00% NA
All Japonica  1512 27.60% 72.40% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 77.70% 22.30% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.10% 0.13% 0.00% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 69.80% 30.20% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019827961 C -> T LOC_Os10g37020.1 missense_variant ; p.Pro349Leu; MODERATE nonsynonymous_codon ; P349L Average:58.692; most accessible tissue: Zhenshan97 flower, score: 90.238 benign 1.101 DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1019827961 C T 0.02 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019827961 NA 1.84E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1019827961 NA 4.60E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 9.96E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.39E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.43E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.50E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.28E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.43E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 2.23E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 5.68E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.98E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.90E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 4.36E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 1.83E-06 1.83E-06 mr1905 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 6.94E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 6.36E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.75E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.26E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 4.02E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.29E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 5.09E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 4.26E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.97E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.72E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 7.43E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 4.56E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.18E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.30E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019827961 NA 1.04E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251