\
| Variant ID: vg1019669777 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 19669777 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTTTAGTCCCAGATTGTGCGTCCCAGTTGCTGAACTGGACTAAAAACAGTTGCGAACCGGGACTAGCTTTGTTTCTATCGGTTTTACTAGTTTTCATTAA[G/A]
TCAGTGAGGAGCGGTTCCAACTCCATCCATGCCCACCACGAACCTCTCCGGTGAGAAATTTTCCGGCTCTACAATTTTCGGTTCTGTTTTCGGGGAAAAT
ATTTTCCCCGAAAACAGAACCGAAAATTGTAGAGCCGGAAAATTTCTCACCGGAGAGGTTCGTGGTGGGCATGGATGGAGTTGGAACCGCTCCTCACTGA[C/T]
TTAATGAAAACTAGTAAAACCGATAGAAACAAAGCTAGTCCCGGTTCGCAACTGTTTTTAGTCCAGTTCAGCAACTGGGACGCACAATCTGGGACTAAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 12.80% | 0.95% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.00% | 38.00% | 2.98% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 28.80% | 67.10% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 2.40% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 19.90% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1019669777 | G -> A | LOC_Os10g36729.1 | upstream_gene_variant ; 860.0bp to feature; MODIFIER | silent_mutation | Average:45.619; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| vg1019669777 | G -> A | LOC_Os10g36740.1 | upstream_gene_variant ; 1738.0bp to feature; MODIFIER | silent_mutation | Average:45.619; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| vg1019669777 | G -> A | LOC_Os10g36729-LOC_Os10g36740 | intergenic_region ; MODIFIER | silent_mutation | Average:45.619; most accessible tissue: Zhenshan97 young leaf, score: 66.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1019669777 | 3.63E-07 | NA | mr1208 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 9.45E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 1.93E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 7.57E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 4.56E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 7.33E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 3.22E-12 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019669777 | NA | 3.63E-09 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |