Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1019398073:

Variant ID: vg1019398073 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19398073
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGGCACTAATAAAAAAACTAATTACATAATCCGTCAATAAACCGAGAGACGAATTTATTAAGCTTAATTAATCTGTCATTAGCAAATGTTTACTGTAG[A/C]
ATCACATTGTTAAATCATGGAGCAATTAAGCTTAAAAGATCCGTCTGTAAATTAGTCGCAATCTGTGCAATTAGTTATTTTTTAGCCTATATTTAATACT

Reverse complement sequence

AGTATTAAATATAGGCTAAAAAATAACTAATTGCACAGATTGCGACTAATTTACAGACGGATCTTTTAAGCTTAATTGCTCCATGATTTAACAATGTGAT[T/G]
CTACAGTAAACATTTGCTAATGACAGATTAATTAAGCTTAATAAATTCGTCTCTCGGTTTATTGACGGATTATGTAATTAGTTTTTTTATTAGTGCCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	26.00%	6.98%	34.64%	NA
All Indica	2759	47.50%	2.20%	9.24%	41.03%	NA
All Japonica	1512	12.30%	72.80%	4.17%	10.71%	NA
Aus	269	4.10%	0.70%	1.49%	93.68%	NA
Indica I	595	65.50%	3.00%	17.48%	13.95%	NA
Indica II	465	49.70%	2.20%	5.38%	42.80%	NA
Indica III	913	36.60%	1.20%	5.70%	56.52%	NA
Indica Intermediate	786	45.30%	2.80%	9.41%	42.49%	NA
Temperate Japonica	767	2.20%	95.20%	0.52%	2.09%	NA
Tropical Japonica	504	31.70%	33.10%	10.32%	24.80%	NA
Japonica Intermediate	241	3.70%	84.60%	2.90%	8.71%	NA
VI/Aromatic	96	1.00%	36.50%	4.17%	58.33%	NA
Intermediate	90	25.60%	31.10%	4.44%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019398073	A -> C	LOC_Os10g36280.1	upstream_gene_variant ; 799.0bp to feature; MODIFIER	silent_mutation	Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg1019398073	A -> C	LOC_Os10g36270.1	downstream_gene_variant ; 1332.0bp to feature; MODIFIER	silent_mutation	Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg1019398073	A -> C	LOC_Os10g36270-LOC_Os10g36280	intergenic_region ; MODIFIER	silent_mutation	Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg1019398073	A -> DEL	N	N	silent_mutation	Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019398073	NA	5.09E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	2.71E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	8.49E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	2.03E-16	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	3.75E-13	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	1.33E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	6.96E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	3.36E-06	7.04E-06	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	1.57E-06	9.99E-07	mr1128_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	1.14E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	7.35E-13	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	2.28E-13	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	6.48E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	1.15E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	1.79E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073	NA	1.12E-12	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251