\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019398073:

Variant ID: vg1019398073 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19398073
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGCACTAATAAAAAAACTAATTACATAATCCGTCAATAAACCGAGAGACGAATTTATTAAGCTTAATTAATCTGTCATTAGCAAATGTTTACTGTAG[A/C]
ATCACATTGTTAAATCATGGAGCAATTAAGCTTAAAAGATCCGTCTGTAAATTAGTCGCAATCTGTGCAATTAGTTATTTTTTAGCCTATATTTAATACT

Reverse complement sequence

AGTATTAAATATAGGCTAAAAAATAACTAATTGCACAGATTGCGACTAATTTACAGACGGATCTTTTAAGCTTAATTGCTCCATGATTTAACAATGTGAT[T/G]
CTACAGTAAACATTTGCTAATGACAGATTAATTAAGCTTAATAAATTCGTCTCTCGGTTTATTGACGGATTATGTAATTAGTTTTTTTATTAGTGCCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 26.00% 6.98% 34.64% NA
All Indica  2759 47.50% 2.20% 9.24% 41.03% NA
All Japonica  1512 12.30% 72.80% 4.17% 10.71% NA
Aus  269 4.10% 0.70% 1.49% 93.68% NA
Indica I  595 65.50% 3.00% 17.48% 13.95% NA
Indica II  465 49.70% 2.20% 5.38% 42.80% NA
Indica III  913 36.60% 1.20% 5.70% 56.52% NA
Indica Intermediate  786 45.30% 2.80% 9.41% 42.49% NA
Temperate Japonica  767 2.20% 95.20% 0.52% 2.09% NA
Tropical Japonica  504 31.70% 33.10% 10.32% 24.80% NA
Japonica Intermediate  241 3.70% 84.60% 2.90% 8.71% NA
VI/Aromatic  96 1.00% 36.50% 4.17% 58.33% NA
Intermediate  90 25.60% 31.10% 4.44% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019398073 A -> C LOC_Os10g36280.1 upstream_gene_variant ; 799.0bp to feature; MODIFIER silent_mutation Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg1019398073 A -> C LOC_Os10g36270.1 downstream_gene_variant ; 1332.0bp to feature; MODIFIER silent_mutation Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg1019398073 A -> C LOC_Os10g36270-LOC_Os10g36280 intergenic_region ; MODIFIER silent_mutation Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg1019398073 A -> DEL N N silent_mutation Average:21.985; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019398073 NA 5.09E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 2.71E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 8.49E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 2.03E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 3.75E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 1.33E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 6.96E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 3.36E-06 7.04E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 1.57E-06 9.99E-07 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 1.14E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 7.35E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 2.28E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 6.48E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 1.15E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 1.79E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019398073 NA 1.12E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251