\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019397969:

Variant ID: vg1019397969 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19397969
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TGATAGGGACTAAAACTTTTTAGTCCCATCCAAACAAGGTCATAAGGGGGTGTTTAGTTTTGGCGTGTCACATCAGGTATTATATAGGGTGTCGCATGGG[A/G]
TATTCGGGCACTAATAAAAAAACTAATTACATAATCCGTCAATAAACCGAGAGACGAATTTATTAAGCTTAATTAATCTGTCATTAGCAAATGTTTACTG

Reverse complement sequence

CAGTAAACATTTGCTAATGACAGATTAATTAAGCTTAATAAATTCGTCTCTCGGTTTATTGACGGATTATGTAATTAGTTTTTTTATTAGTGCCCGAATA[T/C]
CCCATGCGACACCCTATATAATACCTGATGTGACACGCCAAAACTAAACACCCCCTTATGACCTTGTTTGGATGGGACTAAAAAGTTTTAGTCCCTATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 25.30% 0.19% 29.52% NA
All Indica  2759 63.00% 1.80% 0.25% 34.94% NA
All Japonica  1512 22.40% 72.40% 0.07% 5.22% NA
Aus  269 5.60% 0.40% 0.00% 94.05% NA
Indica I  595 92.80% 2.90% 0.00% 4.37% NA
Indica II  465 58.30% 1.90% 0.22% 39.57% NA
Indica III  913 48.00% 1.00% 0.33% 50.71% NA
Indica Intermediate  786 60.70% 1.90% 0.38% 37.02% NA
Temperate Japonica  767 2.90% 94.90% 0.13% 2.09% NA
Tropical Japonica  504 57.90% 32.10% 0.00% 9.92% NA
Japonica Intermediate  241 10.00% 84.60% 0.00% 5.39% NA
VI/Aromatic  96 4.20% 28.10% 0.00% 67.71% NA
Intermediate  90 34.40% 26.70% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019397969 A -> G LOC_Os10g36280.1 upstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1019397969 A -> G LOC_Os10g36270.1 downstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1019397969 A -> G LOC_Os10g36270-LOC_Os10g36280 intergenic_region ; MODIFIER silent_mutation Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1019397969 A -> DEL N N silent_mutation Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019397969 NA 5.09E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 2.71E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 8.49E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 2.03E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 3.75E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 1.33E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 6.96E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 3.21E-06 NA mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 6.32E-06 4.16E-06 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 1.14E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 8.41E-06 NA mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 7.35E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 2.28E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 6.48E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 1.15E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 1.79E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 1.12E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969 NA 3.44E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251