Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019397969:

Variant ID: vg1019397969 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19397969
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TGATAGGGACTAAAACTTTTTAGTCCCATCCAAACAAGGTCATAAGGGGGTGTTTAGTTTTGGCGTGTCACATCAGGTATTATATAGGGTGTCGCATGGG[A/G]
TATTCGGGCACTAATAAAAAAACTAATTACATAATCCGTCAATAAACCGAGAGACGAATTTATTAAGCTTAATTAATCTGTCATTAGCAAATGTTTACTG

Reverse complement sequence

CAGTAAACATTTGCTAATGACAGATTAATTAAGCTTAATAAATTCGTCTCTCGGTTTATTGACGGATTATGTAATTAGTTTTTTTATTAGTGCCCGAATA[T/C]
CCCATGCGACACCCTATATAATACCTGATGTGACACGCCAAAACTAAACACCCCCTTATGACCTTGTTTGGATGGGACTAAAAAGTTTTAGTCCCTATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	25.30%	0.19%	29.52%	NA
All Indica	2759	63.00%	1.80%	0.25%	34.94%	NA
All Japonica	1512	22.40%	72.40%	0.07%	5.22%	NA
Aus	269	5.60%	0.40%	0.00%	94.05%	NA
Indica I	595	92.80%	2.90%	0.00%	4.37%	NA
Indica II	465	58.30%	1.90%	0.22%	39.57%	NA
Indica III	913	48.00%	1.00%	0.33%	50.71%	NA
Indica Intermediate	786	60.70%	1.90%	0.38%	37.02%	NA
Temperate Japonica	767	2.90%	94.90%	0.13%	2.09%	NA
Tropical Japonica	504	57.90%	32.10%	0.00%	9.92%	NA
Japonica Intermediate	241	10.00%	84.60%	0.00%	5.39%	NA
VI/Aromatic	96	4.20%	28.10%	0.00%	67.71%	NA
Intermediate	90	34.40%	26.70%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019397969	A -> G	LOC_Os10g36280.1	upstream_gene_variant ; 903.0bp to feature; MODIFIER	silent_mutation	Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1019397969	A -> G	LOC_Os10g36270.1	downstream_gene_variant ; 1228.0bp to feature; MODIFIER	silent_mutation	Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1019397969	A -> G	LOC_Os10g36270-LOC_Os10g36280	intergenic_region ; MODIFIER	silent_mutation	Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1019397969	A -> DEL	N	N	silent_mutation	Average:21.612; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019397969	NA	5.09E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	2.71E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	8.49E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	2.03E-16	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	3.75E-13	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	1.33E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	6.96E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	3.21E-06	NA	mr1053_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	6.32E-06	4.16E-06	mr1128_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	1.14E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	8.41E-06	NA	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	7.35E-13	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	2.28E-13	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	6.48E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	1.15E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	1.79E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	1.12E-12	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019397969	NA	3.44E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251