\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019396898:

Variant ID: vg1019396898 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19396898
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGCAAAGCAAATTACACGAACTATCTTTCCATTCTCGCTGTTTCATTATAAAATGTTTTAAGTTTCCTTTCAAAAAAAATGTTTTAAGTTTGTTTTAG[T/C]
CAAACTTGTTCGAGTTTGATTAAATTTATAGAAAAACATAATAATATTTATAAAACAGAATTAGCTTCTTTATATCCACATTGAGTATATTTTCATTGTA

Reverse complement sequence

TACAATGAAAATATACTCAATGTGGATATAAAGAAGCTAATTCTGTTTTATAAATATTATTATGTTTTTCTATAAATTTAATCAAACTCGAACAAGTTTG[A/G]
CTAAAACAAACTTAAAACATTTTTTTTGAAAGGAAACTTAAAACATTTTATAATGAAACAGCGAGAATGGAAAGATAGTTCGTGTAATTTGCTTTGCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 25.50% 0.23% 29.50% NA
All Indica  2759 62.80% 1.90% 0.29% 34.98% NA
All Japonica  1512 22.30% 72.50% 0.07% 5.16% NA
Aus  269 4.50% 1.90% 0.00% 93.68% NA
Indica I  595 93.60% 2.00% 0.34% 4.03% NA
Indica II  465 58.50% 1.90% 0.00% 39.57% NA
Indica III  913 47.20% 1.20% 0.44% 51.15% NA
Indica Intermediate  786 60.30% 2.50% 0.25% 36.90% NA
Temperate Japonica  767 2.90% 94.90% 0.13% 2.09% NA
Tropical Japonica  504 57.70% 32.30% 0.00% 9.92% NA
Japonica Intermediate  241 10.00% 85.10% 0.00% 4.98% NA
VI/Aromatic  96 3.10% 29.20% 0.00% 67.71% NA
Intermediate  90 35.60% 24.40% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019396898 T -> C LOC_Os10g36280.1 upstream_gene_variant ; 1974.0bp to feature; MODIFIER silent_mutation Average:13.547; most accessible tissue: Callus, score: 50.028 N N N N
vg1019396898 T -> C LOC_Os10g36270.1 downstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:13.547; most accessible tissue: Callus, score: 50.028 N N N N
vg1019396898 T -> C LOC_Os10g36270-LOC_Os10g36280 intergenic_region ; MODIFIER silent_mutation Average:13.547; most accessible tissue: Callus, score: 50.028 N N N N
vg1019396898 T -> DEL N N silent_mutation Average:13.547; most accessible tissue: Callus, score: 50.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019396898 NA 5.09E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 2.71E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 8.49E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 2.03E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 3.75E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 1.33E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 6.96E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 1.14E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 2.33E-06 NA mr1558_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 7.35E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 2.28E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 6.48E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 1.15E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 1.79E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396898 NA 1.12E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251