\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019396556:

Variant ID: vg1019396556 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19396556
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTAAGCCTCTTTTGTTTGATTCCGTAACAGTTTCAGAATGTAAGTTAAGCCTAGTGTGCCTCAAATGTCCTACATGATCTTGTTTGTGGAGAAATCAT[C/A]
TTTCTTCTGTAATGTAAAGTACTGTTTCATATGTATTAACTTGGATAAACGTGCCAGCAAAAGCACAATGCCAGAATGGGAACCAAAATGACCCAGTATG

Reverse complement sequence

CATACTGGGTCATTTTGGTTCCCATTCTGGCATTGTGCTTTTGCTGGCACGTTTATCCAAGTTAATACATATGAAACAGTACTTTACATTACAGAAGAAA[G/T]
ATGATTTCTCCACAAACAAGATCATGTAGGACATTTGAGGCACACTAGGCTTAACTTACATTCTGAAACTGTTACGGAATCAAACAAAAGAGGCTTAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 25.20% 0.28% 29.26% NA
All Indica  2759 63.40% 1.60% 0.36% 34.69% NA
All Japonica  1512 22.40% 72.40% 0.07% 5.16% NA
Aus  269 5.60% 1.10% 0.37% 92.94% NA
Indica I  595 93.80% 1.80% 0.17% 4.20% NA
Indica II  465 58.50% 1.50% 0.65% 39.35% NA
Indica III  913 48.10% 1.10% 0.22% 50.60% NA
Indica Intermediate  786 61.10% 1.90% 0.51% 36.51% NA
Temperate Japonica  767 2.90% 94.90% 0.13% 2.09% NA
Tropical Japonica  504 57.90% 32.10% 0.00% 9.92% NA
Japonica Intermediate  241 10.00% 85.10% 0.00% 4.98% NA
VI/Aromatic  96 4.20% 28.10% 0.00% 67.71% NA
Intermediate  90 35.60% 26.70% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019396556 C -> A LOC_Os10g36270.1 3_prime_UTR_variant ; 156.0bp to feature; MODIFIER silent_mutation Average:32.611; most accessible tissue: Callus, score: 88.515 N N N N
vg1019396556 C -> A LOC_Os10g36280.1 upstream_gene_variant ; 2316.0bp to feature; MODIFIER silent_mutation Average:32.611; most accessible tissue: Callus, score: 88.515 N N N N
vg1019396556 C -> DEL N N silent_mutation Average:32.611; most accessible tissue: Callus, score: 88.515 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019396556 NA 9.51E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 2.28E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 5.54E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 9.58E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 2.42E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 2.10E-12 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 4.68E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 5.34E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 2.95E-06 6.50E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 5.36E-07 3.13E-06 mr1608_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 1.99E-12 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 1.88E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 5.52E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 3.33E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 8.67E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 NA 4.35E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396556 8.79E-06 8.78E-06 mr1940_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251