\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019396223:

Variant ID: vg1019396223 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19396223
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, A: 0.27, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTACCCAACGGTCTCCAACGCCTGCGAGAATTGGAAGACATGGAGGTTGTAGGATGTGGAAAGCTTACCTGCCTCCCGGAGATGAGAAAACTTACTTC[A/C]
CTAGAAAGACTGGAGATTTCAGAATGTGGCTCGATTCAGTCCCTGCCAAGTAAAGGTTTGCCCAAGAAACTGCAGTTCTTGAGCGTAAACAAATGCCCAT

Reverse complement sequence

ATGGGCATTTGTTTACGCTCAAGAACTGCAGTTTCTTGGGCAAACCTTTACTTGGCAGGGACTGAATCGAGCCACATTCTGAAATCTCCAGTCTTTCTAG[T/G]
GAAGTAAGTTTTCTCATCTCCGGGAGGCAGGTAAGCTTTCCACATCCTACAACCTCCATGTCTTCCAATTCTCGCAGGCGTTGGAGACCGTTGGGTAGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.10% 17.80% 14.37% 42.68% NA
All Indica  2759 1.40% 26.00% 20.62% 51.94% NA
All Japonica  1512 72.40% 6.50% 6.35% 14.75% NA
Aus  269 0.70% 4.50% 1.12% 93.68% NA
Indica I  595 1.80% 47.20% 21.18% 29.75% NA
Indica II  465 1.70% 28.00% 21.94% 48.39% NA
Indica III  913 0.70% 10.20% 21.25% 67.91% NA
Indica Intermediate  786 1.90% 27.10% 18.70% 52.29% NA
Temperate Japonica  767 94.90% 0.80% 0.91% 3.39% NA
Tropical Japonica  504 32.10% 17.50% 16.67% 33.73% NA
Japonica Intermediate  241 84.60% 2.10% 2.07% 11.20% NA
VI/Aromatic  96 27.10% 4.20% 1.04% 67.71% NA
Intermediate  90 27.80% 12.20% 11.11% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019396223 A -> C LOC_Os10g36270.1 synonymous_variant ; p.Ser649Ser; LOW synonymous_codon Average:38.39; most accessible tissue: Callus, score: 88.942 N N N N
vg1019396223 A -> DEL LOC_Os10g36270.1 N frameshift_variant Average:38.39; most accessible tissue: Callus, score: 88.942 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019396223 NA 5.36E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 2.36E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 6.71E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 1.52E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 4.58E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 1.63E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 5.84E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 1.58E-06 NA mr1152_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 1.64E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 6.30E-06 NA mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 9.91E-06 mr1597_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 4.38E-06 NA mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 7.47E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 3.07E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 9.58E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 1.31E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 1.51E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396223 NA 3.69E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251