Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019395575:

Variant ID: vg1019395575 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19395575
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTTCAGGTTATACCGGCATATCGTGTCCTATCTGGCTTGGTTCTGAAAGCTACACGAATCTAGTCACTTTGTCACTCTATCATTTCAAGAGCTGCAC[C/T]
GTTGTTCCTTCCCTTTGGCTATTACCTCTTTTGGAAAATCTCCACATCAAGGGATGGGATGCATTGGTTAAATTTTGTGGTAGCAGTTCTGCCAATTTCC

Reverse complement sequence

GGAAATTGGCAGAACTGCTACCACAAAATTTAACCAATGCATCCCATCCCTTGATGTGGAGATTTTCCAAAAGAGGTAATAGCCAAAGGGAAGGAACAAC[G/A]
GTGCAGCTCTTGAAATGATAGAGTGACAAAGTGACTAGATTCGTGTAGCTTTCAGAACCAAGCCAGATAGGACACGATATGCCGGTATAACCTGAAATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	25.00%	0.34%	29.33%	NA
All Indica	2759	63.50%	1.40%	0.40%	34.69%	NA
All Japonica	1512	22.40%	72.30%	0.07%	5.22%	NA
Aus	269	5.60%	0.40%	1.12%	92.94%	NA
Indica I	595	93.80%	1.80%	0.17%	4.20%	NA
Indica II	465	58.70%	1.10%	0.43%	39.78%	NA
Indica III	913	48.40%	0.70%	0.55%	50.38%	NA
Indica Intermediate	786	60.90%	2.20%	0.38%	36.51%	NA
Temperate Japonica	767	3.00%	94.80%	0.13%	2.09%	NA
Tropical Japonica	504	57.90%	32.10%	0.00%	9.92%	NA
Japonica Intermediate	241	10.00%	84.60%	0.00%	5.39%	NA
VI/Aromatic	96	4.20%	27.10%	0.00%	68.75%	NA
Intermediate	90	35.60%	25.60%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019395575	C -> T	LOC_Os10g36270.1	synonymous_variant ; p.Thr433Thr; LOW	synonymous_codon	Average:33.228; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg1019395575	C -> DEL	LOC_Os10g36270.1	N	frameshift_variant	Average:33.228; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1019395575	C	T	0.04	0.0	0.02	0.03	0.05	0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019395575	NA	6.51E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	5.48E-07	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	7.17E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	4.78E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	8.14E-16	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	2.75E-11	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	2.90E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	1.03E-07	1.87E-07	mr1608_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	1.35E-12	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	2.23E-12	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	7.61E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	5.22E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575	NA	1.51E-12	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251