\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019395575:

Variant ID: vg1019395575 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19395575
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTTCAGGTTATACCGGCATATCGTGTCCTATCTGGCTTGGTTCTGAAAGCTACACGAATCTAGTCACTTTGTCACTCTATCATTTCAAGAGCTGCAC[C/T]
GTTGTTCCTTCCCTTTGGCTATTACCTCTTTTGGAAAATCTCCACATCAAGGGATGGGATGCATTGGTTAAATTTTGTGGTAGCAGTTCTGCCAATTTCC

Reverse complement sequence

GGAAATTGGCAGAACTGCTACCACAAAATTTAACCAATGCATCCCATCCCTTGATGTGGAGATTTTCCAAAAGAGGTAATAGCCAAAGGGAAGGAACAAC[G/A]
GTGCAGCTCTTGAAATGATAGAGTGACAAAGTGACTAGATTCGTGTAGCTTTCAGAACCAAGCCAGATAGGACACGATATGCCGGTATAACCTGAAATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.30% 25.00% 0.34% 29.33% NA
All Indica  2759 63.50% 1.40% 0.40% 34.69% NA
All Japonica  1512 22.40% 72.30% 0.07% 5.22% NA
Aus  269 5.60% 0.40% 1.12% 92.94% NA
Indica I  595 93.80% 1.80% 0.17% 4.20% NA
Indica II  465 58.70% 1.10% 0.43% 39.78% NA
Indica III  913 48.40% 0.70% 0.55% 50.38% NA
Indica Intermediate  786 60.90% 2.20% 0.38% 36.51% NA
Temperate Japonica  767 3.00% 94.80% 0.13% 2.09% NA
Tropical Japonica  504 57.90% 32.10% 0.00% 9.92% NA
Japonica Intermediate  241 10.00% 84.60% 0.00% 5.39% NA
VI/Aromatic  96 4.20% 27.10% 0.00% 68.75% NA
Intermediate  90 35.60% 25.60% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019395575 C -> T LOC_Os10g36270.1 synonymous_variant ; p.Thr433Thr; LOW synonymous_codon Average:33.228; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg1019395575 C -> DEL LOC_Os10g36270.1 N frameshift_variant Average:33.228; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1019395575 C T 0.04 0.0 0.02 0.03 0.05 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019395575 NA 6.51E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 5.48E-07 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 7.17E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 4.78E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 8.14E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 2.75E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 2.90E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 1.03E-07 1.87E-07 mr1608_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 1.35E-12 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 2.23E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 7.61E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 5.22E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019395575 NA 1.51E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251