\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019373991:

Variant ID: vg1019373991 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19373991
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTACTGTTTTACCACCAGTTCATATATTCATTTTTTTTTTGCATAAATACCAACACGCGTCATTTACTCTGAGAAGGCGAAACGTGGTGCACATGCAG[T/C]
GGGAGACCAGGAGGACCGGTGGGGAAACCGGACAAAAAAAAAGGAACGGTTCCATTGCTCACCCAATCGAGGAGTTTCTGCACCTGCATAGTACATGGCA

Reverse complement sequence

TGCCATGTACTATGCAGGTGCAGAAACTCCTCGATTGGGTGAGCAATGGAACCGTTCCTTTTTTTTTGTCCGGTTTCCCCACCGGTCCTCCTGGTCTCCC[A/G]
CTGCATGTGCACCACGTTTCGCCTTCTCAGAGTAAATGACGCGTGTTGGTATTTATGCAAAAAAAAAATGAATATATGAACTGGTGGTAAAACAGTACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 31.30% 7.70% 18.62% NA
All Indica  2759 27.90% 34.90% 11.05% 26.17% NA
All Japonica  1512 76.20% 10.80% 3.11% 9.85% NA
Aus  269 8.60% 89.60% 1.12% 0.74% NA
Indica I  595 5.70% 28.10% 24.54% 41.68% NA
Indica II  465 22.80% 53.80% 7.53% 15.91% NA
Indica III  913 49.00% 23.90% 4.49% 22.67% NA
Indica Intermediate  786 23.20% 41.70% 10.56% 24.55% NA
Temperate Japonica  767 95.40% 3.00% 0.52% 1.04% NA
Tropical Japonica  504 42.10% 24.00% 7.94% 25.99% NA
Japonica Intermediate  241 86.30% 8.30% 1.24% 4.15% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 41.10% 42.20% 8.89% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019373991 T -> C LOC_Os10g36229.1 downstream_gene_variant ; 183.0bp to feature; MODIFIER silent_mutation Average:68.182; most accessible tissue: Callus, score: 99.901 N N N N
vg1019373991 T -> C LOC_Os10g36250.1 downstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:68.182; most accessible tissue: Callus, score: 99.901 N N N N
vg1019373991 T -> C LOC_Os10g36229-LOC_Os10g36250 intergenic_region ; MODIFIER silent_mutation Average:68.182; most accessible tissue: Callus, score: 99.901 N N N N
vg1019373991 T -> DEL N N silent_mutation Average:68.182; most accessible tissue: Callus, score: 99.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019373991 NA 1.33E-09 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 8.96E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.23E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.03E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 8.27E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.30E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.95E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.87E-20 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 3.28E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.96E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.55E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.39E-14 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.31E-07 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 6.94E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.09E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.98E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.46E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 3.91E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.21E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.07E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.44E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.78E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 3.21E-11 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.37E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 7.97E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 3.20E-15 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 5.71E-10 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 2.66E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019373991 NA 1.11E-11 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251