\
| Variant ID: vg1019363923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 19363923 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCCCTAGATTAGTTCTATAATTCTTGGCTAGTGGATGATTCTTTCTATACTTCTTAGCTAGTGGATTGATTCCCGTTCTCTTATTTCTTGCTAGTCATT[T/C]
CCGGCCCGAATTTGAATCCGGGCATAACCGAACAAGGCCTAGGGATCCCTCGCCGCGTGTCCTTCCGCAGCGTGCCCTCCGGTGATGCCGCCGCATGAAG
CTTCATGCGGCGGCATCACCGGAGGGCACGCTGCGGAAGGACACGCGGCGAGGGATCCCTAGGCCTTGTTCGGTTATGCCCGGATTCAAATTCGGGCCGG[A/G]
AATGACTAGCAAGAAATAAGAGAACGGGAATCAATCCACTAGCTAAGAAGTATAGAAAGAATCATCCACTAGCCAAGAATTATAGAACTAATCTAGGGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 24.50% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 0.90% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.00% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.10% | 31.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.40% | 84.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1019363923 | T -> C | LOC_Os10g36229.1 | upstream_gene_variant ; 85.0bp to feature; MODIFIER | silent_mutation | Average:51.927; most accessible tissue: Callus, score: 76.87 | N | N | N | N |
| vg1019363923 | T -> C | LOC_Os10g36210.1 | downstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:51.927; most accessible tissue: Callus, score: 76.87 | N | N | N | N |
| vg1019363923 | T -> C | LOC_Os10g36210-LOC_Os10g36229 | intergenic_region ; MODIFIER | silent_mutation | Average:51.927; most accessible tissue: Callus, score: 76.87 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1019363923 | NA | 1.04E-36 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1019363923 | NA | 4.02E-59 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1019363923 | NA | 4.30E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1019363923 | NA | 6.39E-19 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.00E-09 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.17E-87 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.45E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.21E-10 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.53E-06 | mr1368 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 4.02E-07 | mr1509 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.68E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.76E-24 | mr1584 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.75E-10 | mr1584 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.28E-07 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | 1.31E-06 | 2.03E-51 | mr1771 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 7.34E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.88E-73 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | 9.60E-06 | 1.92E-44 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.45E-11 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.04E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 5.43E-14 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.17E-27 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.95E-08 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.58E-07 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 8.17E-73 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.84E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 5.55E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 9.42E-52 | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.49E-12 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.26E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.25E-55 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 6.36E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.07E-22 | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 6.92E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 6.55E-98 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.41E-21 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.70E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.02E-36 | mr1368_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.91E-11 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 4.41E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.20E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 9.43E-30 | mr1584_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.79E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.05E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | 2.49E-06 | 9.43E-48 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 6.18E-12 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.90E-75 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | 7.92E-06 | 4.81E-52 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.35E-12 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 4.61E-16 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 7.65E-09 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.37E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 5.34E-14 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 3.33E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 2.97E-45 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 8.03E-11 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019363923 | NA | 1.70E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |