\
| Variant ID: vg1019348557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 19348557 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCTTCTCTTCCGAGCGATTCAGACCGGTCATCTCCATGCATTGTGTGTGAAAGAAACTGTGAACAGCTAATCAAAATCAAGGTGCACGCCGAAATTGCCA[A/G]
ATGTAACAGATGACTACTTACTCCCTCCGTTTCATGAGATAAATCATTCTAGCACTTTCCACATTCATCAAGTTATTATAGCCCTTCTTATATTTATCAC
GTGATAAATATAAGAAGGGCTATAATAACTTGATGAATGTGGAAAGTGCTAGAATGATTTATCTCATGAAACGGAGGGAGTAAGTAGTCATCTGTTACAT[T/C]
TGGCAATTTCGGCGTGCACCTTGATTTTGATTAGCTGTTCACAGTTTCTTTCACACACAATGCATGGAGATGACCGGTCTGAATCGCTCGGAAGAGAAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.70% | 1.50% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.00% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 94.50% | 4.70% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 0.00% | 3.19% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.30% | 12.70% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1019348557 | A -> G | LOC_Os10g36190.1 | upstream_gene_variant ; 1604.0bp to feature; MODIFIER | silent_mutation | Average:70.052; most accessible tissue: Callus, score: 90.244 | N | N | N | N |
| vg1019348557 | A -> G | LOC_Os10g36180.1 | downstream_gene_variant ; 251.0bp to feature; MODIFIER | silent_mutation | Average:70.052; most accessible tissue: Callus, score: 90.244 | N | N | N | N |
| vg1019348557 | A -> G | LOC_Os10g36200.1 | downstream_gene_variant ; 4421.0bp to feature; MODIFIER | silent_mutation | Average:70.052; most accessible tissue: Callus, score: 90.244 | N | N | N | N |
| vg1019348557 | A -> G | LOC_Os10g36200.2 | downstream_gene_variant ; 4421.0bp to feature; MODIFIER | silent_mutation | Average:70.052; most accessible tissue: Callus, score: 90.244 | N | N | N | N |
| vg1019348557 | A -> G | LOC_Os10g36180-LOC_Os10g36190 | intergenic_region ; MODIFIER | silent_mutation | Average:70.052; most accessible tissue: Callus, score: 90.244 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1019348557 | NA | 1.80E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019348557 | NA | 2.37E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019348557 | 2.18E-06 | 1.17E-07 | mr1794 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019348557 | NA | 5.04E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |