\
| Variant ID: vg1019343930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 19343930 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
GATCTACTTAGTACAACAATTCCAATATACCTGGTGGAACATCGTGTAACATTTAAAAATAATTCAATAATTAGGTAAAAAAAATTTCGTCGGAATATAT[C/T]
CATGTGTGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGATGTAATCGGATCATAATTTAAATAAGTAATTTAAGAGAAAAATCAGTTTAAAAT
ATTTTAAACTGATTTTTCTCTTAAATTACTTATTTAAATTATGATCCGATTACATCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCACACATG[G/A]
ATATATTCCGACGAAATTTTTTTTACCTAATTATTGAATTATTTTTAAATGTTACACGATGTTCCACCAGGTATATTGGAATTGTTGTACTAAGTAGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 15.50% | 0.80% | 24.42% | NA |
| All Indica | 2759 | 45.40% | 14.00% | 1.20% | 39.40% | NA |
| All Japonica | 1512 | 95.20% | 1.80% | 0.07% | 2.91% | NA |
| Aus | 269 | 8.60% | 89.60% | 0.37% | 1.49% | NA |
| Indica I | 595 | 76.30% | 0.00% | 1.01% | 22.69% | NA |
| Indica II | 465 | 21.90% | 44.70% | 0.86% | 32.47% | NA |
| Indica III | 913 | 36.70% | 3.30% | 1.64% | 58.38% | NA |
| Indica Intermediate | 786 | 46.10% | 18.80% | 1.02% | 34.10% | NA |
| Temperate Japonica | 767 | 97.80% | 1.80% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 91.90% | 0.40% | 0.00% | 7.74% | NA |
| Japonica Intermediate | 241 | 94.20% | 4.60% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 36.50% | 60.40% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 55.60% | 23.30% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1019343930 | C -> T | LOC_Os10g36180.1 | upstream_gene_variant ; 2404.0bp to feature; MODIFIER | silent_mutation | Average:41.571; most accessible tissue: Callus, score: 96.286 | N | N | N | N |
| vg1019343930 | C -> T | LOC_Os10g36170-LOC_Os10g36180 | intergenic_region ; MODIFIER | silent_mutation | Average:41.571; most accessible tissue: Callus, score: 96.286 | N | N | N | N |
| vg1019343930 | C -> DEL | N | N | silent_mutation | Average:41.571; most accessible tissue: Callus, score: 96.286 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1019343930 | NA | 5.94E-06 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 3.56E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 1.26E-12 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 2.14E-13 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 2.04E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 4.12E-07 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 3.10E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 1.07E-20 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 1.05E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 4.02E-09 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 1.17E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 1.51E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 2.68E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 3.76E-13 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1019343930 | NA | 2.15E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |