Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019228132:

Variant ID: vg1019228132 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19228132
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGTTACAAATGGCCATTTCATCATTTTGTTGGACAAGCCATTCTCACTACAAACAATTTACAGAGTTTTTTTGCTTTCTATACAAATTACAGAACAC[A/C]
TGCAACCCCATTTTTCAGAACAAGTGGTCTGCTGCCTGTGTAAAGAACAATCTATCATTCTAATAACTGCACATTCAGTATCTCCAGAATGCCATTCGGT

Reverse complement sequence

ACCGAATGGCATTCTGGAGATACTGAATGTGCAGTTATTAGAATGATAGATTGTTCTTTACACAGGCAGCAGACCACTTGTTCTGAAAAATGGGGTTGCA[T/G]
GTGTTCTGTAATTTGTATAGAAAGCAAAAAAACTCTGTAAATTGTTTGTAGTGAGAATGGCTTGTCCAACAAAATGATGAAATGGCCATTTGTAACTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.30%	0.61%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	20.40%	77.30%	2.23%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	61.50%	17.70%	20.83%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019228132	A -> C	LOC_Os10g35960.1	downstream_gene_variant ; 4111.0bp to feature; MODIFIER	silent_mutation	Average:59.9; most accessible tissue: Zhenshan97 flag leaf, score: 86.673	N	N	N	N
vg1019228132	A -> C	LOC_Os10g35980.1	downstream_gene_variant ; 2126.0bp to feature; MODIFIER	silent_mutation	Average:59.9; most accessible tissue: Zhenshan97 flag leaf, score: 86.673	N	N	N	N
vg1019228132	A -> C	LOC_Os10g35960-LOC_Os10g35980	intergenic_region ; MODIFIER	silent_mutation	Average:59.9; most accessible tissue: Zhenshan97 flag leaf, score: 86.673	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019228132	NA	2.98E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	6.08E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	5.81E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	5.16E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	3.74E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.11E-44	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	2.99E-54	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.93E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.70E-46	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.20E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.18E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.67E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	6.72E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	9.34E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	6.51E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	1.79E-40	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	5.98E-08	1.39E-66	mr1550_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	4.10E-38	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019228132	NA	2.75E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251